Mutagenetix > Incidental Mutation

Incidental Mutation 'R2393:Hsp90aa1'

247888

Institutional Source

Beutler Lab

Gene Symbol

Hsp90aa1

Ensembl Gene

ENSMUSG00000021270

Gene Name

heat shock protein 90, alpha (cytosolic), class A member 1

Synonyms

hsp4, Hspca, Hsp90, Hsp86-1, Hsp89

MMRRC Submission

040361-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2393 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110690605-110702728 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110693406 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 416 (N416S)

Ref Sequence

ENSEMBL: ENSMUSP00000091921 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021698] [ENSMUST00000094361] [ENSMUST00000124156] [ENSMUST00000149189] [ENSMUST00000155242]

AlphaFold

P07901

Predicted Effect

probably damaging
Transcript: ENSMUST00000021698
AA Change: N416S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021698
Gene: ENSMUSG00000021270
AA Change: N416S

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	733	6.7e-272	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000094361
AA Change: N416S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000091921
Gene: ENSMUSG00000021270
AA Change: N416S

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART
Pfam:HSP90	196	728	2e-245	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000124156

SMART Domains

Protein: ENSMUSP00000121138
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	103	1e-69	PDB
SCOP:d1byqa_	11	103	5e-48	SMART
Blast:HATPase_c	40	103	7e-39	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134967

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145255

Predicted Effect

probably benign
Transcript: ENSMUST00000149189

SMART Domains

Protein: ENSMUSP00000114201
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
PDB:3HHU\|B	1	98	6e-66	PDB
SCOP:d1byqa_	11	98	2e-45	SMART
Blast:HATPase_c	40	98	2e-35	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155242

SMART Domains

Protein: ENSMUSP00000118189
Gene: ENSMUSG00000021270

Domain	Start	End	E-Value	Type
HATPase_c	40	194	2.94e-11	SMART

Meta Mutation Damage Score

0.6997

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

100% (54/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inducible molecular chaperone that functions as a homodimer. The encoded protein aids in the proper folding of specific target proteins by use of an ATPase activity that is modulated by co-chaperones. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit male sterility associated with arrested male meiosis and male germ cell apoptosis. Mice homozygous for a transgenic gene disruption exhibit male sterility and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,275,057	L512*	probably null	Het
Adam4	A	T	12: 81,420,711	F379I	probably benign	Het
Ano6	C	G	15: 95,966,025		probably benign	Het
Apc2	A	G	10: 80,313,069	E1319G	possibly damaging	Het
Arfgef3	A	G	10: 18,597,787	V1588A	possibly damaging	Het
Arl8a	T	A	1: 135,152,866	V93E	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Cd200r2	T	A	16: 44,909,267	I95N	probably damaging	Het
Cd209d	A	G	8: 3,878,436		probably null	Het
Cep290	A	G	10: 100,561,238		probably null	Het
Chd2	G	T	7: 73,507,883	D171E	possibly damaging	Het
Chrna7	G	A	7: 63,099,246	A496V	probably damaging	Het
Col9a2	C	G	4: 121,054,258	R599G	probably damaging	Het
Colgalt1	C	G	8: 71,623,741	T612S	probably benign	Het
Copg2	T	C	6: 30,810,958	K602E	probably benign	Het
Crtc1	T	A	8: 70,388,158	T473S	probably benign	Het
Ctbp2	A	T	7: 133,023,561		probably null	Het
Edem1	T	G	6: 108,852,543	M541R	probably damaging	Het
Ehmt1	A	C	2: 24,806,217	V953G	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fgfr2	T	C	7: 130,227,238		probably null	Het
Focad	A	G	4: 88,121,330	D10G	probably damaging	Het
Gm5901	G	T	7: 105,377,789	V255F	possibly damaging	Het
Hspb1	T	C	5: 135,889,096	F142L	probably benign	Het
Il17re	C	T	6: 113,462,353	H75Y	possibly damaging	Het
Kctd3	A	G	1: 188,981,371	I389T	probably damaging	Het
Lhx6	T	C	2: 36,091,390	D63G	probably benign	Het
Mepe	A	G	5: 104,337,461	T156A	possibly damaging	Het
Met	A	G	6: 17,534,198	Y680C	probably damaging	Het
Mrgpra3	T	C	7: 47,589,617	Y187C	possibly damaging	Het
Mst1	T	G	9: 108,082,952		probably null	Het
Myh13	T	A	11: 67,340,358	S394T	possibly damaging	Het
Nbeal1	T	A	1: 60,251,370	V1042E	probably damaging	Het
Ndrg4	T	A	8: 95,706,211	Y15*	probably null	Het
Neurl4	G	A	11: 69,907,074	R720H	probably damaging	Het
Nfkbia	A	G	12: 55,490,670		probably benign	Het
Nwd1	T	A	8: 72,662,427	M202K	probably benign	Het
Olfr332	T	A	11: 58,490,720	I12F	probably benign	Het
Olfr963	G	T	9: 39,669,273	C72F	possibly damaging	Het
Pate2	T	C	9: 35,669,740		probably benign	Het
Pibf1	A	G	14: 99,242,932	T715A	probably benign	Het
Pitpnm1	T	C	19: 4,110,935	L858P	probably benign	Het
Pla2g3	A	C	11: 3,493,115	S483R	probably benign	Het
Rad51ap2	T	A	12: 11,457,797	D573E	probably damaging	Het
Rho	T	C	6: 115,935,391		probably benign	Het
Rpl39l	A	T	16: 10,174,464	*52L	probably null	Het
Slco1a5	T	A	6: 142,248,775	R381W	possibly damaging	Het
Spns3	T	A	11: 72,550,233		probably benign	Het
Srgap2	A	G	1: 131,332,134	S493P	probably benign	Het
Tecpr2	T	C	12: 110,926,402	S293P	probably damaging	Het
Tsta3	G	T	15: 75,926,351	L191I	probably damaging	Het
Ttn	C	T	2: 76,752,867	V20815M	probably benign	Het
Ushbp1	T	C	8: 71,394,488	I167V	probably benign	Het
Wdr81	C	T	11: 75,449,405	A1296T	probably damaging	Het
Zmym2	A	G	14: 56,920,723	Y573C	probably benign	Het

Other mutations in Hsp90aa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02056:Hsp90aa1	APN	12	110694015	unclassified	probably benign
IGL02243:Hsp90aa1	APN	12	110695091	missense	probably damaging	1.00
IGL02865:Hsp90aa1	APN	12	110693082	missense	probably benign	0.11
IGL02965:Hsp90aa1	APN	12	110695679	start codon destroyed	probably null	0.95
R0827:Hsp90aa1	UTSW	12	110692695	missense	probably benign	0.38
R1331:Hsp90aa1	UTSW	12	110692820	missense	probably damaging	1.00
R1498:Hsp90aa1	UTSW	12	110695688	splice site	probably null
R2039:Hsp90aa1	UTSW	12	110693782	missense	probably damaging	1.00
R2082:Hsp90aa1	UTSW	12	110692827	missense	probably damaging	1.00
R2102:Hsp90aa1	UTSW	12	110694132	missense	probably damaging	0.99
R2169:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	0.99
R2194:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2194:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2359:Hsp90aa1	UTSW	12	110694569	critical splice donor site	probably null
R2364:Hsp90aa1	UTSW	12	110692753	missense	probably damaging	0.99
R2398:Hsp90aa1	UTSW	12	110692321	missense	possibly damaging	0.86
R2435:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2435:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2924:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2924:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R2925:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R2925:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3176:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3176:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3177:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3177:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3276:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3276:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3277:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3277:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3615:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3615:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R3616:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R3616:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4033:Hsp90aa1	UTSW	12	110695680	start codon destroyed	possibly damaging	0.59
R4033:Hsp90aa1	UTSW	12	110695681	critical splice acceptor site	probably null
R4815:Hsp90aa1	UTSW	12	110695226	missense	possibly damaging	0.45
R4932:Hsp90aa1	UTSW	12	110693717	missense	probably damaging	1.00
R5117:Hsp90aa1	UTSW	12	110695264	missense	possibly damaging	0.71
R5555:Hsp90aa1	UTSW	12	110692734	missense	probably damaging	1.00
R6382:Hsp90aa1	UTSW	12	110695517	critical splice donor site	probably null
R7024:Hsp90aa1	UTSW	12	110694112	missense	possibly damaging	0.46
R7324:Hsp90aa1	UTSW	12	110695225	missense	unknown
R7447:Hsp90aa1	UTSW	12	110692128	missense	possibly damaging	0.94
R7526:Hsp90aa1	UTSW	12	110695294	missense	unknown
R7732:Hsp90aa1	UTSW	12	110693418	missense	probably damaging	1.00
R8155:Hsp90aa1	UTSW	12	110695394	missense	unknown
R9004:Hsp90aa1	UTSW	12	110692611	missense	probably damaging	0.99
R9145:Hsp90aa1	UTSW	12	110696250	critical splice donor site	probably null
Z1177:Hsp90aa1	UTSW	12	110693466	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCAAGCTGAAGCACAAGC -3'
(R):5'- AGACAGAAAATCCCATTCGTTGG -3'

Sequencing Primer
(F):5'- GGAAAGCCATTTATGAAGCATTAGCC -3'
(R):5'- GAGACGGGGTTTGCCTAAC -3'

Posted On

2014-11-11