Mutagenetix > Incidental Mutation

Incidental Mutation 'R2394:Tpp2'

247898

Institutional Source

Beutler Lab

Gene Symbol

Tpp2

Ensembl Gene

ENSMUSG00000041763

Gene Name

tripeptidyl peptidase II

Synonyms

TppII

MMRRC Submission

040362-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.607) question?

Stock #

R2394 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43973130-44042160 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 44022346 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 915 (S915T)

Ref Sequence

ENSEMBL: ENSMUSP00000139918 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087933] [ENSMUST00000188302] [ENSMUST00000188313] [ENSMUST00000189388] [ENSMUST00000190207]

AlphaFold

Q64514

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087933
AA Change: S915T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000085244
Gene: ENSMUSG00000041763
AA Change: S915T

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	35	500	1.4e-96	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	777	964	2.4e-80	PFAM
low complexity region	1017	1033	N/A	INTRINSIC
PDB:3LXU\|X	1034	1262	1e-20	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000188302

SMART Domains

Protein: ENSMUSP00000140474
Gene: ENSMUSG00000041763

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	4.3e-84	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000188313
AA Change: S915T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000139918
Gene: ENSMUSG00000041763
AA Change: S915T

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	5.1e-83	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	966	2.7e-93	PFAM
low complexity region	1004	1020	N/A	INTRINSIC
PDB:3LXU\|X	1021	1249	1e-20	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000189388

SMART Domains

Protein: ENSMUSP00000140562
Gene: ENSMUSG00000041763

Domain	Start	End	E-Value	Type
Pfam:Peptidase_S8	39	509	2.3e-81	PFAM
low complexity region	674	685	N/A	INTRINSIC
Pfam:TPPII	773	880	7.8e-49	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000190207

SMART Domains

Protein: ENSMUSP00000140313
Gene: ENSMUSG00000041763

Domain	Start	End	E-Value	Type
low complexity region	70	86	N/A	INTRINSIC
PDB:3LXU\|X	87	281	3e-19	PDB

Meta Mutation Damage Score

0.0845

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.0%

Validation Efficiency

100% (41/41)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mammalian peptidase that, at neutral pH, removes tripeptides from the N terminus of longer peptides. The protein has a specialized function that is essential for some MHC class I antigen presentation. The protein is a high molecular mass serine exopeptidase; the amino acid sequence surrounding the serine residue at the active site is similar to the peptidases of the subtilisin class rather than the trypsin class. [provided by RefSeq, Jul 2008]
PHENOTYPE: Engineered mutations of this gene result in decreased lifespan and symptoms of immunohematopoietic senescence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700020L13Rik	A	T	7: 29,980,053 (GRCm39)		probably benign	Het
Abca17	T	C	17: 24,500,190 (GRCm39)		probably null	Het
Atxn7	T	C	14: 14,100,237 (GRCm38)	V641A	probably damaging	Het
C3	G	A	17: 57,529,303 (GRCm39)	Q30*	probably null	Het
Ccdc162	A	G	10: 41,445,894 (GRCm39)	I426T	probably damaging	Het
Col9a2	C	G	4: 120,911,455 (GRCm39)	R599G	probably damaging	Het
Cwc27	A	C	13: 104,932,942 (GRCm39)	D253E	probably benign	Het
Cyp1a1	T	A	9: 57,607,432 (GRCm39)	V20D	probably benign	Het
Dmbt1	T	A	7: 130,696,464 (GRCm39)	Y892*	probably null	Het
Dnhd1	T	A	7: 105,369,438 (GRCm39)	Y4354N	probably benign	Het
Dync2li1	T	A	17: 84,952,175 (GRCm39)	I202K	possibly damaging	Het
Dyrk1a	T	A	16: 94,485,991 (GRCm39)	V446E	probably benign	Het
Efcab3	C	A	11: 104,629,121 (GRCm39)	T933K	probably benign	Het
Fam186b	T	C	15: 99,178,058 (GRCm39)	I423V	probably benign	Het
Gm5108	T	C	5: 68,132,475 (GRCm39)		probably benign	Het
Htr3a	A	G	9: 48,817,643 (GRCm39)	V110A	probably benign	Het
Itsn2	C	A	12: 4,757,005 (GRCm39)	S1365Y	possibly damaging	Het
Lrrc46	T	C	11: 96,929,657 (GRCm39)	I60V	probably damaging	Het
Mtrex	A	T	13: 113,019,702 (GRCm39)	Y803N	probably benign	Het
Nlrp14	T	C	7: 106,797,031 (GRCm39)	V307A	probably benign	Het
Nt5c2	A	G	19: 46,878,506 (GRCm39)		probably null	Het
Obox2	C	T	7: 15,130,935 (GRCm39)	P56S	possibly damaging	Het
Olfml2b	A	G	1: 170,477,319 (GRCm39)	I151M	possibly damaging	Het
Oog3	T	A	4: 143,885,884 (GRCm39)	D238V	probably benign	Het
Pde11a	T	C	2: 75,889,405 (GRCm39)	T690A	probably benign	Het
Ppa1	A	G	10: 61,508,163 (GRCm39)		probably benign	Het
Ppfia2	A	G	10: 106,655,351 (GRCm39)	E306G	probably damaging	Het
Ppic	G	A	18: 53,544,119 (GRCm39)	R89C	probably damaging	Het
Ptprk	T	G	10: 28,427,713 (GRCm39)	I764S	probably damaging	Het
Ripk2	T	C	4: 16,132,774 (GRCm39)		probably benign	Het
Rnf123	A	G	9: 107,940,735 (GRCm39)	M702T	probably benign	Het
Slco1b2	T	C	6: 141,615,100 (GRCm39)	I335T	probably damaging	Het
Ssbp1	T	A	6: 40,453,743 (GRCm39)	D96E	probably benign	Het
Unc5c	A	T	3: 141,383,892 (GRCm39)	Q90L	probably damaging	Het
Vmn2r57	A	G	7: 41,049,619 (GRCm39)	I710T	possibly damaging	Het
Wdr90	G	A	17: 26,070,429 (GRCm39)	P1104L	probably damaging	Het

Other mutations in Tpp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00977:Tpp2	APN	1	44,022,451 (GRCm39)	missense	possibly damaging	0.90
IGL01021:Tpp2	APN	1	43,973,347 (GRCm39)	nonsense	probably null
IGL01096:Tpp2	APN	1	44,000,048 (GRCm39)	missense	probably damaging	1.00
IGL01344:Tpp2	APN	1	44,022,422 (GRCm39)	missense	probably benign	0.04
IGL01642:Tpp2	APN	1	43,993,813 (GRCm39)	missense	probably damaging	1.00
IGL02719:Tpp2	APN	1	43,979,391 (GRCm39)	missense	probably benign	0.09
IGL02890:Tpp2	APN	1	44,038,850 (GRCm39)	missense	probably damaging	1.00
IGL03102:Tpp2	APN	1	43,995,649 (GRCm39)	missense	probably damaging	1.00
IGL03175:Tpp2	APN	1	44,012,671 (GRCm39)	missense	probably benign	0.35
beaver	UTSW	1	44,010,875 (GRCm39)	missense	probably benign	0.08
billingsly	UTSW	1	44,022,712 (GRCm39)	missense	probably damaging	1.00
cleaver	UTSW	1	44,017,668 (GRCm39)	nonsense	probably null
dow	UTSW	1	44,009,552 (GRCm39)	splice site	probably benign
Eddie	UTSW	1	44,008,148 (GRCm39)	missense	probably damaging	1.00
jerry	UTSW	1	44,017,897 (GRCm39)	missense	probably benign	0.04
June	UTSW	1	43,993,870 (GRCm39)	missense	probably damaging	1.00
landers	UTSW	1	44,016,415 (GRCm39)	missense	probably damaging	1.00
mathers	UTSW	1	44,031,428 (GRCm39)	missense	probably damaging	1.00
recurrentis	UTSW	1	44,031,553 (GRCm39)	missense	probably null	0.29
state	UTSW	1	44,017,598 (GRCm39)	missense	possibly damaging	0.48
wally	UTSW	1	44,031,556 (GRCm39)	critical splice donor site	probably null
Ward	UTSW	1	43,993,896 (GRCm39)	missense	possibly damaging	0.82
wilson	UTSW	1	44,011,849 (GRCm39)	critical splice donor site	probably null
BB010:Tpp2	UTSW	1	44,000,121 (GRCm39)	missense	probably damaging	1.00
BB020:Tpp2	UTSW	1	44,000,121 (GRCm39)	missense	probably damaging	1.00
R0001:Tpp2	UTSW	1	44,010,886 (GRCm39)	missense	probably benign	0.00
R0003:Tpp2	UTSW	1	43,999,299 (GRCm39)	missense	possibly damaging	0.94
R0066:Tpp2	UTSW	1	44,020,908 (GRCm39)	missense	possibly damaging	0.56
R0110:Tpp2	UTSW	1	44,017,664 (GRCm39)	missense	probably benign	0.00
R0110:Tpp2	UTSW	1	44,038,853 (GRCm39)	missense	probably damaging	1.00
R0167:Tpp2	UTSW	1	44,009,648 (GRCm39)	missense	probably benign	0.01
R0441:Tpp2	UTSW	1	44,029,722 (GRCm39)	missense	possibly damaging	0.85
R0520:Tpp2	UTSW	1	44,029,690 (GRCm39)	missense	probably damaging	1.00
R0639:Tpp2	UTSW	1	44,014,607 (GRCm39)	missense	probably benign	0.00
R1118:Tpp2	UTSW	1	44,031,556 (GRCm39)	critical splice donor site	probably null
R1119:Tpp2	UTSW	1	44,031,556 (GRCm39)	critical splice donor site	probably null
R1593:Tpp2	UTSW	1	44,014,593 (GRCm39)	missense	probably benign	0.01
R1702:Tpp2	UTSW	1	44,029,708 (GRCm39)	missense	probably damaging	0.99
R1756:Tpp2	UTSW	1	44,017,885 (GRCm39)	splice site	probably null
R2066:Tpp2	UTSW	1	44,017,598 (GRCm39)	missense	possibly damaging	0.48
R2171:Tpp2	UTSW	1	43,996,606 (GRCm39)	missense	probably benign	0.00
R2378:Tpp2	UTSW	1	44,038,925 (GRCm39)	missense	probably damaging	0.99
R2507:Tpp2	UTSW	1	44,040,609 (GRCm39)	missense	probably benign	0.31
R2879:Tpp2	UTSW	1	44,010,783 (GRCm39)	missense	probably damaging	1.00
R3436:Tpp2	UTSW	1	43,979,304 (GRCm39)	missense	probably damaging	0.99
R4106:Tpp2	UTSW	1	44,040,617 (GRCm39)	missense	possibly damaging	0.71
R4658:Tpp2	UTSW	1	43,993,870 (GRCm39)	missense	probably damaging	1.00
R4760:Tpp2	UTSW	1	44,010,875 (GRCm39)	missense	probably benign	0.08
R4963:Tpp2	UTSW	1	44,031,428 (GRCm39)	missense	probably damaging	1.00
R5049:Tpp2	UTSW	1	44,040,633 (GRCm39)	missense	possibly damaging	0.46
R5073:Tpp2	UTSW	1	43,993,896 (GRCm39)	missense	possibly damaging	0.82
R6010:Tpp2	UTSW	1	43,990,373 (GRCm39)	critical splice donor site	probably null
R6118:Tpp2	UTSW	1	43,979,306 (GRCm39)	missense	probably damaging	1.00
R6155:Tpp2	UTSW	1	43,995,649 (GRCm39)	missense	probably damaging	1.00
R6169:Tpp2	UTSW	1	44,022,739 (GRCm39)	missense	probably damaging	0.99
R6236:Tpp2	UTSW	1	44,016,477 (GRCm39)	missense	probably benign	0.01
R6695:Tpp2	UTSW	1	44,022,436 (GRCm39)	missense	probably benign
R6845:Tpp2	UTSW	1	44,017,668 (GRCm39)	nonsense	probably null
R7054:Tpp2	UTSW	1	44,022,318 (GRCm39)	missense	probably damaging	1.00
R7094:Tpp2	UTSW	1	44,008,148 (GRCm39)	missense	probably damaging	1.00
R7223:Tpp2	UTSW	1	44,008,048 (GRCm39)	missense	probably damaging	1.00
R7316:Tpp2	UTSW	1	44,009,591 (GRCm39)	missense	probably benign	0.00
R7324:Tpp2	UTSW	1	44,017,938 (GRCm39)	missense	probably damaging	1.00
R7363:Tpp2	UTSW	1	44,024,582 (GRCm39)	missense	probably benign	0.00
R7454:Tpp2	UTSW	1	43,993,819 (GRCm39)	missense	probably benign	0.01
R7496:Tpp2	UTSW	1	44,022,677 (GRCm39)	missense	probably benign	0.09
R7699:Tpp2	UTSW	1	44,009,626 (GRCm39)	missense	probably benign
R7700:Tpp2	UTSW	1	44,009,626 (GRCm39)	missense	probably benign
R7804:Tpp2	UTSW	1	44,022,441 (GRCm39)	missense	probably benign	0.00
R7933:Tpp2	UTSW	1	44,000,121 (GRCm39)	missense	probably damaging	1.00
R7979:Tpp2	UTSW	1	43,979,297 (GRCm39)	missense	probably benign	0.35
R8032:Tpp2	UTSW	1	44,014,628 (GRCm39)	missense	possibly damaging	0.82
R8101:Tpp2	UTSW	1	44,009,600 (GRCm39)	missense	probably damaging	1.00
R8245:Tpp2	UTSW	1	44,022,712 (GRCm39)	missense	probably damaging	1.00
R8314:Tpp2	UTSW	1	43,973,387 (GRCm39)	missense	probably benign	0.10
R8518:Tpp2	UTSW	1	44,019,545 (GRCm39)	missense	probably damaging	1.00
R8519:Tpp2	UTSW	1	44,016,365 (GRCm39)	critical splice acceptor site	probably null
R8529:Tpp2	UTSW	1	44,022,300 (GRCm39)	missense	probably benign
R8756:Tpp2	UTSW	1	43,999,295 (GRCm39)	nonsense	probably null
R8765:Tpp2	UTSW	1	44,011,849 (GRCm39)	critical splice donor site	probably null
R8773:Tpp2	UTSW	1	44,009,552 (GRCm39)	splice site	probably benign
R8915:Tpp2	UTSW	1	44,016,415 (GRCm39)	missense	probably damaging	1.00
R9049:Tpp2	UTSW	1	43,992,502 (GRCm39)	missense	possibly damaging	0.66
R9090:Tpp2	UTSW	1	43,993,811 (GRCm39)	missense	probably damaging	1.00
R9176:Tpp2	UTSW	1	44,031,553 (GRCm39)	missense	probably null	0.29
R9214:Tpp2	UTSW	1	44,031,514 (GRCm39)	missense	probably benign
R9271:Tpp2	UTSW	1	43,993,811 (GRCm39)	missense	probably damaging	1.00
R9316:Tpp2	UTSW	1	44,017,604 (GRCm39)	missense	probably damaging	0.97
R9371:Tpp2	UTSW	1	43,999,369 (GRCm39)	missense	probably damaging	1.00
R9422:Tpp2	UTSW	1	44,017,897 (GRCm39)	missense	probably benign	0.04
R9488:Tpp2	UTSW	1	44,041,272 (GRCm39)	missense	probably benign	0.03
R9513:Tpp2	UTSW	1	44,017,648 (GRCm39)	missense	probably benign	0.01
R9514:Tpp2	UTSW	1	44,017,648 (GRCm39)	missense	probably benign	0.01
R9516:Tpp2	UTSW	1	44,017,648 (GRCm39)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GTACACTCTGTAAATGGAACTGTGTC -3'
(R):5'- TCAAGGAGCCTGCAAGGTAG -3'

Sequencing Primer
(F):5'- TGTAAATGGAACTGTGTCTTTTATCC -3'
(R):5'- GCCCCCTTAGGTATTCTAATGAGAG -3'

Posted On

2014-11-11