Mutagenetix > Incidental Mutation

Incidental Mutation 'R0299:Muc2'

24790

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

038513-MU

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R0299 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 141752729 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 296 (T296I)

Ref Sequence

ENSEMBL: ENSMUSP00000026590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000026590
AA Change: T296I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: T296I

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187945
AA Change: T735I

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 98.8%
3x: 97.8%
10x: 95.3%
20x: 90.1%

Validation Efficiency

100% (61/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930503L19Rik	G	A	18: 70,469,482	Q87*	probably null	Het
4933427I04Rik	A	T	4: 123,860,822	R176S	possibly damaging	Het
A2ml1	T	G	6: 128,553,232		probably benign	Het
Abca13	G	A	11: 9,298,076	E2608K	probably benign	Het
Acpp	T	C	9: 104,320,002	E146G	probably damaging	Het
Adcy8	T	A	15: 64,716,166	D894V	probably damaging	Het
Ap4b1	T	C	3: 103,809,946	M1T	probably null	Het
Arg2	A	G	12: 79,147,612	D70G	probably damaging	Het
Atxn1	A	G	13: 45,567,169	S417P	probably damaging	Het
Btbd10	A	T	7: 113,329,878	S230T	possibly damaging	Het
Carmil1	T	A	13: 24,082,020	N253I	probably damaging	Het
Celf6	C	A	9: 59,602,878	T86K	probably benign	Het
Clec2h	T	C	6: 128,670,895	V69A	probably damaging	Het
Col15a1	A	T	4: 47,262,950	D534V	probably damaging	Het
Col16a1	TCCCC	TCCC	4: 130,058,318		probably null	Het
Degs1	A	T	1: 182,279,271	I141N	probably damaging	Het
Dnah1	C	T	14: 31,276,158	G2574D	probably damaging	Het
Dnah8	T	A	17: 30,715,509	F1489L	possibly damaging	Het
Dock10	T	C	1: 80,536,929	R1424G	probably damaging	Het
Elp2	T	C	18: 24,634,409	I716T	probably benign	Het
Frk	T	C	10: 34,484,371		probably null	Het
Fshr	C	G	17: 89,009,285	S169T	probably benign	Het
Gin1	T	A	1: 97,783,016	S141R	possibly damaging	Het
Gm11596	G	A	11: 99,792,944	P117S	unknown	Het
Gm6327	T	C	16: 12,761,197		noncoding transcript	Het
Hepacam2	A	G	6: 3,476,121	L268P	probably damaging	Het
Hps6	G	A	19: 46,004,232	V203M	probably damaging	Het
Hsd17b7	G	A	1: 169,959,794		probably benign	Het
Il18rap	A	T	1: 40,525,058	H112L	probably benign	Het
Il1r2	T	A	1: 40,123,149	Y317*	probably null	Het
Ints8	C	A	4: 11,246,097	V190L	probably benign	Het
Me2	A	G	18: 73,770,673	S575P	probably benign	Het
Mecom	A	G	3: 29,980,411	L372P	probably benign	Het
Mss51	T	A	14: 20,484,688	Q338L	possibly damaging	Het
Muc4	A	T	16: 32,750,195		probably benign	Het
Neto1	G	A	18: 86,461,320	R211Q	probably benign	Het
Nisch	A	G	14: 31,171,924	Y1231H	probably damaging	Het
Olfr1331	A	G	4: 118,869,416	I212V	probably benign	Het
Olfr1338	A	T	4: 118,754,535	M1K	probably null	Het
Pcsk6	T	C	7: 66,039,043	V820A	probably benign	Het
Pdcd10	T	C	3: 75,527,651	K111R	probably damaging	Het
Pdgfrb	T	A	18: 61,068,852	V496E	probably benign	Het
Pelo	A	T	13: 115,088,903	C40*	probably null	Het
Plxnc1	C	T	10: 94,849,821		probably null	Het
Ptpru	G	A	4: 131,803,387	Q519*	probably null	Het
Pzp	A	G	6: 128,495,330		probably benign	Het
Rad21	A	T	15: 51,965,030	D547E	probably benign	Het
Serpina1d	A	T	12: 103,765,757	L281Q	probably damaging	Het
Serpina9	T	C	12: 104,001,470	N222S	probably benign	Het
Sh3bgrl2	A	G	9: 83,577,559	K57E	probably damaging	Het
Shtn1	T	C	19: 59,018,951	E289G	probably benign	Het
Sik3	T	C	9: 46,208,740	M659T	possibly damaging	Het
Slamf7	G	A	1: 171,648,931		probably benign	Het
Sppl3	T	A	5: 115,088,994		probably benign	Het
Suco	G	A	1: 161,853,810	T253I	probably benign	Het
Tecta	T	C	9: 42,352,063	D1409G	probably damaging	Het
Tram2	T	C	1: 21,004,244	D238G	probably damaging	Het
Trpm3	T	C	19: 22,986,873	M1244T	possibly damaging	Het
Trub1	A	G	19: 57,483,625	T178A	possibly damaging	Het
Ugcg	G	C	4: 59,217,036	V187L	possibly damaging	Het
Vmn1r25	T	A	6: 57,978,509	Q265L	probably damaging	Het
Zfp821	G	T	8: 109,724,230	R285L	probably damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R4900:Muc2	UTSW	7	141749543	missense	probably benign	0.32
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- TGGCACTTGTTCATACACAGCCTC -3'
(R):5'- GTGGCATCCGTTACAGTCTTGGAG -3'

Sequencing Primer
(F):5'- TACACAGCCTCCCCCTGG -3'
(R):5'- gagacagaagaggaggcac -3'

Posted On

2013-04-16