Incidental Mutation 'R0299:Muc2'
ID 24790
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 038513-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R0299 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 141306466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 296 (T296I)
Ref Sequence ENSEMBL: ENSMUSP00000026590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026590]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000026590
AA Change: T296I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: T296I

DomainStartEndE-ValueType
C8 1 63 1.65e-11 SMART
VWC 120 188 5.48e-2 SMART
VWC 229 293 2.38e-11 SMART
Blast:VWD 299 363 4e-17 BLAST
CT 380 463 3.6e-35 SMART
Predicted Effect unknown
Transcript: ENSMUST00000187945
AA Change: T735I
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,602,553 (GRCm39) Q87* probably null Het
4933427I04Rik A T 4: 123,754,615 (GRCm39) R176S possibly damaging Het
A2ml1 T G 6: 128,530,195 (GRCm39) probably benign Het
Abca13 G A 11: 9,248,076 (GRCm39) E2608K probably benign Het
Acp3 T C 9: 104,197,201 (GRCm39) E146G probably damaging Het
Adcy8 T A 15: 64,588,015 (GRCm39) D894V probably damaging Het
Ap4b1 T C 3: 103,717,262 (GRCm39) M1T probably null Het
Arg2 A G 12: 79,194,386 (GRCm39) D70G probably damaging Het
Atxn1 A G 13: 45,720,645 (GRCm39) S417P probably damaging Het
Btbd10 A T 7: 112,929,085 (GRCm39) S230T possibly damaging Het
Carmil1 T A 13: 24,266,003 (GRCm39) N253I probably damaging Het
Celf6 C A 9: 59,510,161 (GRCm39) T86K probably benign Het
Clec2h T C 6: 128,647,858 (GRCm39) V69A probably damaging Het
Col15a1 A T 4: 47,262,950 (GRCm39) D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 129,952,111 (GRCm39) probably null Het
Degs1 A T 1: 182,106,836 (GRCm39) I141N probably damaging Het
Dnah1 C T 14: 30,998,115 (GRCm39) G2574D probably damaging Het
Dnah8 T A 17: 30,934,483 (GRCm39) F1489L possibly damaging Het
Dock10 T C 1: 80,514,646 (GRCm39) R1424G probably damaging Het
Elp2 T C 18: 24,767,466 (GRCm39) I716T probably benign Het
Frk T C 10: 34,360,367 (GRCm39) probably null Het
Fshr C G 17: 89,316,713 (GRCm39) S169T probably benign Het
Gin1 T A 1: 97,710,741 (GRCm39) S141R possibly damaging Het
Gm11596 G A 11: 99,683,770 (GRCm39) P117S unknown Het
Gm6327 T C 16: 12,579,061 (GRCm39) noncoding transcript Het
Hepacam2 A G 6: 3,476,121 (GRCm39) L268P probably damaging Het
Hps6 G A 19: 45,992,671 (GRCm39) V203M probably damaging Het
Hsd17b7 G A 1: 169,787,363 (GRCm39) probably benign Het
Il18rap A T 1: 40,564,218 (GRCm39) H112L probably benign Het
Il1r2 T A 1: 40,162,309 (GRCm39) Y317* probably null Het
Ints8 C A 4: 11,246,097 (GRCm39) V190L probably benign Het
Me2 A G 18: 73,903,744 (GRCm39) S575P probably benign Het
Mecom A G 3: 30,034,560 (GRCm39) L372P probably benign Het
Mss51 T A 14: 20,534,756 (GRCm39) Q338L possibly damaging Het
Muc4 A T 16: 32,569,013 (GRCm39) probably benign Het
Neto1 G A 18: 86,479,445 (GRCm39) R211Q probably benign Het
Nisch A G 14: 30,893,881 (GRCm39) Y1231H probably damaging Het
Or10ak14 A T 4: 118,611,732 (GRCm39) M1K probably null Het
Or10ak9 A G 4: 118,726,613 (GRCm39) I212V probably benign Het
Pcsk6 T C 7: 65,688,791 (GRCm39) V820A probably benign Het
Pdcd10 T C 3: 75,434,958 (GRCm39) K111R probably damaging Het
Pdgfrb T A 18: 61,201,924 (GRCm39) V496E probably benign Het
Pelo A T 13: 115,225,439 (GRCm39) C40* probably null Het
Plxnc1 C T 10: 94,685,683 (GRCm39) probably null Het
Ptpru G A 4: 131,530,698 (GRCm39) Q519* probably null Het
Pzp A G 6: 128,472,293 (GRCm39) probably benign Het
Rad21 A T 15: 51,828,426 (GRCm39) D547E probably benign Het
Serpina1d A T 12: 103,732,016 (GRCm39) L281Q probably damaging Het
Serpina9 T C 12: 103,967,729 (GRCm39) N222S probably benign Het
Sh3bgrl2 A G 9: 83,459,612 (GRCm39) K57E probably damaging Het
Shtn1 T C 19: 59,007,383 (GRCm39) E289G probably benign Het
Sik3 T C 9: 46,120,038 (GRCm39) M659T possibly damaging Het
Slamf7 G A 1: 171,476,499 (GRCm39) probably benign Het
Sppl3 T A 5: 115,227,053 (GRCm39) probably benign Het
Suco G A 1: 161,681,379 (GRCm39) T253I probably benign Het
Tecta T C 9: 42,263,359 (GRCm39) D1409G probably damaging Het
Tram2 T C 1: 21,074,468 (GRCm39) D238G probably damaging Het
Trpm3 T C 19: 22,964,237 (GRCm39) M1244T possibly damaging Het
Trub1 A G 19: 57,472,057 (GRCm39) T178A possibly damaging Het
Ugcg G C 4: 59,217,036 (GRCm39) V187L possibly damaging Het
Vmn1r25 T A 6: 57,955,494 (GRCm39) Q265L probably damaging Het
Zfp821 G T 8: 110,450,862 (GRCm39) R285L probably damaging Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2010:Muc2 UTSW 7 141,287,444 (GRCm39) missense probably damaging 0.99
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGGCACTTGTTCATACACAGCCTC -3'
(R):5'- GTGGCATCCGTTACAGTCTTGGAG -3'

Sequencing Primer
(F):5'- TACACAGCCTCCCCCTGG -3'
(R):5'- gagacagaagaggaggcac -3'
Posted On 2013-04-16