Incidental Mutation 'R2394:Htr3a'
ID247914
Institutional Source Beutler Lab
Gene Symbol Htr3a
Ensembl Gene ENSMUSG00000032269
Gene Name5-hydroxytryptamine (serotonin) receptor 3A
Synonyms5-HT3 receptor
MMRRC Submission 040362-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2394 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location48899213-48911099 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48906343 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 110 (V110A)
Ref Sequence ENSEMBL: ENSMUSP00000003826 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003826] [ENSMUST00000217289]
Predicted Effect probably benign
Transcript: ENSMUST00000003826
AA Change: V110A

PolyPhen 2 Score 0.295 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000003826
Gene: ENSMUSG00000032269
AA Change: V110A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
Pfam:Neur_chan_LBD 40 247 4.7e-57 PFAM
Pfam:Neur_chan_memb 254 480 1.8e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216896
Predicted Effect probably benign
Transcript: ENSMUST00000217289
AA Change: V110A

PolyPhen 2 Score 0.251 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit A of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a hormone, and a mitogen. This receptor causes fast, depolarizing responses in neurons after activation. It appears that the heteromeric combination of A and B subunits is necessary to provide the full functional features of this receptor, since either subunit alone results in receptors with very low conductance and response amplitude. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display a decreased lifespan, cachexia, increased blood urea nitrogen, proteinuria, kidney inflammation, and a hyperdistended and neurogenic urinary bladder. Mice homozygous for a second null mutation display reduced chemical pain persistence responses but are otherwise healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,216 probably null Het
Atxn7 T C 14: 14,100,237 V641A probably damaging Het
C3 G A 17: 57,222,303 Q30* probably null Het
Ccdc162 A G 10: 41,569,898 I426T probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cwc27 A C 13: 104,796,434 D253E probably benign Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dmbt1 T A 7: 131,094,734 Y892* probably null Het
Dnhd1 T A 7: 105,720,231 Y4354N probably benign Het
Dync2li1 T A 17: 84,644,747 I202K possibly damaging Het
Dyrk1a T A 16: 94,685,132 V446E probably benign Het
Fam186b T C 15: 99,280,177 I423V probably benign Het
Gm11639 C A 11: 104,738,295 T933K probably benign Het
Gm5108 T C 5: 67,975,132 probably benign Het
Itsn2 C A 12: 4,707,005 S1365Y possibly damaging Het
Lrrc46 T C 11: 97,038,831 I60V probably damaging Het
Nlrp14 T C 7: 107,197,824 V307A probably benign Het
Nt5c2 A G 19: 46,890,067 probably null Het
Obox2 C T 7: 15,397,010 P56S possibly damaging Het
Olfml2b A G 1: 170,649,750 I151M possibly damaging Het
Oog3 T A 4: 144,159,314 D238V probably benign Het
Pde11a T C 2: 76,059,061 T690A probably benign Het
Ppa1 A G 10: 61,672,384 probably benign Het
Ppfia2 A G 10: 106,819,490 E306G probably damaging Het
Ppic G A 18: 53,411,047 R89C probably damaging Het
Ptprk T G 10: 28,551,717 I764S probably damaging Het
Ripk2 T C 4: 16,132,774 probably benign Het
Rnf123 A G 9: 108,063,536 M702T probably benign Het
Skiv2l2 A T 13: 112,883,168 Y803N probably benign Het
Slco1b2 T C 6: 141,669,374 I335T probably damaging Het
Ssbp1 T A 6: 40,476,809 D96E probably benign Het
Thap8 A T 7: 30,280,628 probably benign Het
Tpp2 T A 1: 43,983,186 S915T possibly damaging Het
Unc5c A T 3: 141,678,131 Q90L probably damaging Het
Vmn2r57 A G 7: 41,400,195 I710T possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Other mutations in Htr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Htr3a APN 9 48904627 missense probably damaging 0.99
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0238:Htr3a UTSW 9 48906386 missense probably benign 0.06
R0403:Htr3a UTSW 9 48908659 missense probably damaging 0.96
R0899:Htr3a UTSW 9 48901452 missense possibly damaging 0.78
R1749:Htr3a UTSW 9 48900933 missense probably damaging 1.00
R1903:Htr3a UTSW 9 48906381 missense probably damaging 1.00
R1942:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2218:Htr3a UTSW 9 48908611 missense probably damaging 1.00
R2402:Htr3a UTSW 9 48901495 missense probably damaging 1.00
R3430:Htr3a UTSW 9 48907388 missense probably benign 0.35
R6042:Htr3a UTSW 9 48904699 missense probably damaging 0.99
R6395:Htr3a UTSW 9 48900571 missense probably benign 0.00
R6407:Htr3a UTSW 9 48901055 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGGTTGTAGCATCCGGTAC -3'
(R):5'- TGCGTCAACACCCAGATTTCC -3'

Sequencing Primer
(F):5'- CAGAGAATTGCATAAAGGAGAGCTTG -3'
(R):5'- AGATTTCCCCCTAGAAGGTGC -3'
Posted On2014-11-11