Incidental Mutation 'R2394:Atxn7'
ID 247926
Institutional Source Beutler Lab
Gene Symbol Atxn7
Ensembl Gene ENSMUSG00000021738
Gene Name ataxin 7
Synonyms Sca7, A430107N12Rik, ataxin-7
MMRRC Submission 040362-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2394 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 8362461-8508323 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 14100237 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 641 (V641A)
Ref Sequence ENSEMBL: ENSMUSP00000153613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022257] [ENSMUST00000223714] [ENSMUST00000223880]
AlphaFold Q8R4I1
Predicted Effect probably damaging
Transcript: ENSMUST00000022257
AA Change: V641A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022257
Gene: ENSMUSG00000021738
AA Change: V641A

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
ZnF_C2H2 135 157 2.47e1 SMART
low complexity region 174 197 N/A INTRINSIC
low complexity region 202 218 N/A INTRINSIC
Pfam:SCA7 313 381 1.4e-30 PFAM
low complexity region 393 413 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 619 647 N/A INTRINSIC
low complexity region 675 713 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223714
AA Change: V641A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000223880
AA Change: V641A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223932
Predicted Effect probably benign
Transcript: ENSMUST00000224315
Meta Mutation Damage Score 0.0740 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The autosomal dominant cerebellar ataxias (ADCA) are a heterogeneous group of neurodegenerative disorders characterized by progressive degeneration of the cerebellum, brain stem and spinal cord. Clinically, ADCA has been divided into three groups: ADCA types I-III. ADCAI is genetically heterogeneous, with five genetic loci, designated spinocerebellar ataxia (SCA) 1, 2, 3, 4 and 6, being assigned to five different chromosomes. ADCAII, which always presents with retinal degeneration (SCA7), and ADCAIII often referred to as the 'pure' cerebellar syndrome (SCA5), are most likely homogeneous disorders. Several SCA genes have been cloned and shown to contain CAG repeats in their coding regions. ADCA is caused by the expansion of the CAG repeats, producing an elongated polyglutamine tract in the corresponding protein. The expanded repeats are variable in size and unstable, usually increasing in size when transmitted to successive generations. This locus has been mapped to chromosome 3, and it has been determined that the diseased allele associated with spinocerebellar ataxia-7 contains 37-306 CAG repeats (near the N-terminus), compared to 4-35 in the normal allele. The encoded protein is a component of the SPT3/TAF9/GCN5 acetyltransferase (STAGA) and TBP-free TAF-containing (TFTC) chromatin remodeling complexes, and it thus plays a role in transcriptional regulation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Heterozygotes for a targeted mutation with an expanded polyglutamine tract exhibit impaired coordination, ataxia, reduced growth, kyphosis, eye defects, poor reproduction, and high mortality at around 4 months. Homozygotes die at 7-8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L13Rik A T 7: 29,980,053 (GRCm39) probably benign Het
Abca17 T C 17: 24,500,190 (GRCm39) probably null Het
C3 G A 17: 57,529,303 (GRCm39) Q30* probably null Het
Ccdc162 A G 10: 41,445,894 (GRCm39) I426T probably damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
Cwc27 A C 13: 104,932,942 (GRCm39) D253E probably benign Het
Cyp1a1 T A 9: 57,607,432 (GRCm39) V20D probably benign Het
Dmbt1 T A 7: 130,696,464 (GRCm39) Y892* probably null Het
Dnhd1 T A 7: 105,369,438 (GRCm39) Y4354N probably benign Het
Dync2li1 T A 17: 84,952,175 (GRCm39) I202K possibly damaging Het
Dyrk1a T A 16: 94,485,991 (GRCm39) V446E probably benign Het
Efcab3 C A 11: 104,629,121 (GRCm39) T933K probably benign Het
Fam186b T C 15: 99,178,058 (GRCm39) I423V probably benign Het
Gm5108 T C 5: 68,132,475 (GRCm39) probably benign Het
Htr3a A G 9: 48,817,643 (GRCm39) V110A probably benign Het
Itsn2 C A 12: 4,757,005 (GRCm39) S1365Y possibly damaging Het
Lrrc46 T C 11: 96,929,657 (GRCm39) I60V probably damaging Het
Mtrex A T 13: 113,019,702 (GRCm39) Y803N probably benign Het
Nlrp14 T C 7: 106,797,031 (GRCm39) V307A probably benign Het
Nt5c2 A G 19: 46,878,506 (GRCm39) probably null Het
Obox2 C T 7: 15,130,935 (GRCm39) P56S possibly damaging Het
Olfml2b A G 1: 170,477,319 (GRCm39) I151M possibly damaging Het
Oog3 T A 4: 143,885,884 (GRCm39) D238V probably benign Het
Pde11a T C 2: 75,889,405 (GRCm39) T690A probably benign Het
Ppa1 A G 10: 61,508,163 (GRCm39) probably benign Het
Ppfia2 A G 10: 106,655,351 (GRCm39) E306G probably damaging Het
Ppic G A 18: 53,544,119 (GRCm39) R89C probably damaging Het
Ptprk T G 10: 28,427,713 (GRCm39) I764S probably damaging Het
Ripk2 T C 4: 16,132,774 (GRCm39) probably benign Het
Rnf123 A G 9: 107,940,735 (GRCm39) M702T probably benign Het
Slco1b2 T C 6: 141,615,100 (GRCm39) I335T probably damaging Het
Ssbp1 T A 6: 40,453,743 (GRCm39) D96E probably benign Het
Tpp2 T A 1: 44,022,346 (GRCm39) S915T possibly damaging Het
Unc5c A T 3: 141,383,892 (GRCm39) Q90L probably damaging Het
Vmn2r57 A G 7: 41,049,619 (GRCm39) I710T possibly damaging Het
Wdr90 G A 17: 26,070,429 (GRCm39) P1104L probably damaging Het
Other mutations in Atxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Atxn7 APN 14 14,096,324 (GRCm38) splice site probably benign
IGL00782:Atxn7 APN 14 14,096,218 (GRCm38) missense possibly damaging 0.78
IGL01405:Atxn7 APN 14 14,100,105 (GRCm38) missense probably benign 0.00
IGL02828:Atxn7 APN 14 14,090,056 (GRCm38) missense probably damaging 1.00
IGL03119:Atxn7 APN 14 14,100,734 (GRCm38) missense probably damaging 1.00
IGL03139:Atxn7 APN 14 14,052,994 (GRCm38) missense probably damaging 0.97
IGL03282:Atxn7 APN 14 14,100,564 (GRCm38) missense probably damaging 0.99
IGL03387:Atxn7 APN 14 14,087,273 (GRCm38) splice site probably benign
Estes_park UTSW 14 14,096,317 (GRCm38) critical splice donor site probably null
Lumpy UTSW 14 14,089,446 (GRCm38) nonsense probably null
Oestes_park UTSW 14 14,096,268 (GRCm38) nonsense probably null
R0034:Atxn7 UTSW 14 14,100,846 (GRCm38) missense probably damaging 0.96
R0408:Atxn7 UTSW 14 14,100,317 (GRCm38) missense probably damaging 1.00
R0853:Atxn7 UTSW 14 14,089,465 (GRCm38) splice site probably benign
R1169:Atxn7 UTSW 14 14,095,468 (GRCm38) missense possibly damaging 0.81
R1678:Atxn7 UTSW 14 14,096,239 (GRCm38) missense probably damaging 1.00
R1802:Atxn7 UTSW 14 14,089,419 (GRCm38) missense probably benign 0.25
R2078:Atxn7 UTSW 14 14,052,975 (GRCm38) missense probably damaging 0.99
R2275:Atxn7 UTSW 14 14,013,268 (GRCm38) missense possibly damaging 0.85
R4118:Atxn7 UTSW 14 14,100,308 (GRCm38) missense probably benign 0.00
R4230:Atxn7 UTSW 14 14,100,381 (GRCm38) missense probably benign 0.00
R4588:Atxn7 UTSW 14 14,096,268 (GRCm38) nonsense probably null
R4688:Atxn7 UTSW 14 14,089,288 (GRCm38) missense probably benign 0.00
R4935:Atxn7 UTSW 14 14,100,401 (GRCm38) missense probably benign
R5041:Atxn7 UTSW 14 14,096,317 (GRCm38) critical splice donor site probably null
R5185:Atxn7 UTSW 14 14,090,063 (GRCm38) missense probably benign 0.04
R5561:Atxn7 UTSW 14 14,089,260 (GRCm38) missense probably benign 0.19
R5641:Atxn7 UTSW 14 14,013,638 (GRCm38) missense probably damaging 0.99
R6490:Atxn7 UTSW 14 14,089,446 (GRCm38) nonsense probably null
R6549:Atxn7 UTSW 14 14,013,087 (GRCm38) missense probably damaging 0.99
R6623:Atxn7 UTSW 14 14,099,972 (GRCm38) missense probably damaging 1.00
R6950:Atxn7 UTSW 14 14,095,511 (GRCm38) missense probably damaging 1.00
R7054:Atxn7 UTSW 14 14,100,878 (GRCm38) missense probably benign 0.08
R7402:Atxn7 UTSW 14 14,095,427 (GRCm38) missense probably damaging 0.98
R7762:Atxn7 UTSW 14 14,100,467 (GRCm38) missense probably damaging 1.00
R8432:Atxn7 UTSW 14 14,013,635 (GRCm38) missense probably benign 0.06
R8786:Atxn7 UTSW 14 14,103,316 (GRCm38) missense possibly damaging 0.78
R9238:Atxn7 UTSW 14 14,089,441 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCAGCAACCACTGTCTCC -3'
(R):5'- TGTTGACAGGTATGGAGTCCC -3'

Sequencing Primer
(F):5'- AACCACTGTCTCCGCGCC -3'
(R):5'- GAGCCACACAGTTTTTCCTAAAAGAG -3'
Posted On 2014-11-11