Incidental Mutation 'R2394:Nt5c2'
ID247935
Institutional Source Beutler Lab
Gene Symbol Nt5c2
Ensembl Gene ENSMUSG00000025041
Gene Name5'-nucleotidase, cytosolic II
SynonymsPNT5, NT5B, cN-II
MMRRC Submission 040362-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R2394 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location46886831-47015153 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 46890067 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086961] [ENSMUST00000168536] [ENSMUST00000172239]
Predicted Effect probably null
Transcript: ENSMUST00000086961
SMART Domains Protein: ENSMUSP00000084180
Gene: ENSMUSG00000025041

DomainStartEndE-ValueType
Pfam:5_nucleotid 60 518 3.5e-185 PFAM
low complexity region 574 585 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000168536
SMART Domains Protein: ENSMUSP00000129126
Gene: ENSMUSG00000025041

DomainStartEndE-ValueType
Pfam:5_nucleotid 35 493 1.6e-185 PFAM
low complexity region 549 560 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000172239
SMART Domains Protein: ENSMUSP00000130898
Gene: ENSMUSG00000025041

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
Pfam:5_nucleotid 61 515 6.5e-179 PFAM
low complexity region 575 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174731
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hydrolase that serves as an important role in cellular purine metabolism by acting primarily on inosine 5'-monophosphate and other purine nucleotides. [provided by RefSeq, Oct 2011]
PHENOTYPE: Bone marrow cells with a nucleotide substitution allele used in a transplantation experiment following tamoxifen-induction produce NOTCH1-induced tumors that are resistant to 6-mercaptopurine chemotherapy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 T C 17: 24,281,216 probably null Het
Atxn7 T C 14: 14,100,237 V641A probably damaging Het
C3 G A 17: 57,222,303 Q30* probably null Het
Ccdc162 A G 10: 41,569,898 I426T probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
Cwc27 A C 13: 104,796,434 D253E probably benign Het
Cyp1a1 T A 9: 57,700,149 V20D probably benign Het
Dmbt1 T A 7: 131,094,734 Y892* probably null Het
Dnhd1 T A 7: 105,720,231 Y4354N probably benign Het
Dync2li1 T A 17: 84,644,747 I202K possibly damaging Het
Dyrk1a T A 16: 94,685,132 V446E probably benign Het
Fam186b T C 15: 99,280,177 I423V probably benign Het
Gm11639 C A 11: 104,738,295 T933K probably benign Het
Gm5108 T C 5: 67,975,132 probably benign Het
Htr3a A G 9: 48,906,343 V110A probably benign Het
Itsn2 C A 12: 4,707,005 S1365Y possibly damaging Het
Lrrc46 T C 11: 97,038,831 I60V probably damaging Het
Nlrp14 T C 7: 107,197,824 V307A probably benign Het
Obox2 C T 7: 15,397,010 P56S possibly damaging Het
Olfml2b A G 1: 170,649,750 I151M possibly damaging Het
Oog3 T A 4: 144,159,314 D238V probably benign Het
Pde11a T C 2: 76,059,061 T690A probably benign Het
Ppa1 A G 10: 61,672,384 probably benign Het
Ppfia2 A G 10: 106,819,490 E306G probably damaging Het
Ppic G A 18: 53,411,047 R89C probably damaging Het
Ptprk T G 10: 28,551,717 I764S probably damaging Het
Ripk2 T C 4: 16,132,774 probably benign Het
Rnf123 A G 9: 108,063,536 M702T probably benign Het
Skiv2l2 A T 13: 112,883,168 Y803N probably benign Het
Slco1b2 T C 6: 141,669,374 I335T probably damaging Het
Ssbp1 T A 6: 40,476,809 D96E probably benign Het
Thap8 A T 7: 30,280,628 probably benign Het
Tpp2 T A 1: 43,983,186 S915T possibly damaging Het
Unc5c A T 3: 141,678,131 Q90L probably damaging Het
Vmn2r57 A G 7: 41,400,195 I710T possibly damaging Het
Wdr90 G A 17: 25,851,455 P1104L probably damaging Het
Other mutations in Nt5c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Nt5c2 APN 19 46896515 missense possibly damaging 0.91
IGL00814:Nt5c2 APN 19 46897648 missense probably benign 0.02
IGL02347:Nt5c2 APN 19 46924256 splice site probably benign
IGL02630:Nt5c2 APN 19 46924310 missense probably benign 0.00
tightrope UTSW 19 46924327 missense probably damaging 1.00
R0565:Nt5c2 UTSW 19 46897625 missense probably damaging 0.99
R0825:Nt5c2 UTSW 19 46898905 unclassified probably benign
R0980:Nt5c2 UTSW 19 46898878 missense probably benign
R1496:Nt5c2 UTSW 19 46904978 missense probably damaging 1.00
R3854:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3855:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R3856:Nt5c2 UTSW 19 46896518 missense probably damaging 1.00
R4534:Nt5c2 UTSW 19 46891661 missense probably damaging 1.00
R4907:Nt5c2 UTSW 19 46896539 missense possibly damaging 0.71
R5122:Nt5c2 UTSW 19 46889921 missense probably damaging 1.00
R5203:Nt5c2 UTSW 19 46889808 missense probably damaging 1.00
R5226:Nt5c2 UTSW 19 46898629 missense probably damaging 1.00
R5254:Nt5c2 UTSW 19 46893560 nonsense probably null
R5315:Nt5c2 UTSW 19 46892243 missense probably damaging 1.00
R6401:Nt5c2 UTSW 19 46889811 missense probably benign 0.11
R6784:Nt5c2 UTSW 19 46924327 missense probably damaging 1.00
R7040:Nt5c2 UTSW 19 46893535 missense possibly damaging 0.52
R7414:Nt5c2 UTSW 19 46889889 missense probably damaging 1.00
X0028:Nt5c2 UTSW 19 46891615 missense probably damaging 1.00
X0065:Nt5c2 UTSW 19 46890088 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTTGGCTGGCAAAGAGTGTC -3'
(R):5'- TGGCTGAACTCTACAAGTAAGTTTC -3'

Sequencing Primer
(F):5'- TGGCAAAGAGTGTCTGCCG -3'
(R):5'- AGTTTCCCAACTCCACAACTTATGG -3'
Posted On2014-11-11