Incidental Mutation 'R2405:Ror2'
ID247976
Institutional Source Beutler Lab
Gene Symbol Ror2
Ensembl Gene ENSMUSG00000021464
Gene Namereceptor tyrosine kinase-like orphan receptor 2
SynonymsNtrkr2
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2405 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location53109312-53286124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53130944 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 144 (P144L)
Ref Sequence ENSEMBL: ENSMUSP00000123362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021918] [ENSMUST00000130235]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021918
AA Change: P156L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021918
Gene: ENSMUSG00000021464
AA Change: P156L

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IGc2 74 142 5.23e-16 SMART
Pfam:Fz 174 294 1.2e-12 PFAM
KR 314 396 3.94e-45 SMART
transmembrane domain 403 425 N/A INTRINSIC
TyrKc 473 746 1.96e-113 SMART
low complexity region 765 783 N/A INTRINSIC
low complexity region 788 801 N/A INTRINSIC
low complexity region 839 859 N/A INTRINSIC
low complexity region 860 872 N/A INTRINSIC
low complexity region 905 924 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000130235
AA Change: P144L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123362
Gene: ENSMUSG00000021464
AA Change: P144L

DomainStartEndE-ValueType
IGc2 62 130 5.23e-16 SMART
Pfam:Fz 162 289 3.2e-26 PFAM
KR 302 384 3.94e-45 SMART
transmembrane domain 391 413 N/A INTRINSIC
TyrKc 461 734 1.96e-113 SMART
low complexity region 753 771 N/A INTRINSIC
low complexity region 776 789 N/A INTRINSIC
low complexity region 827 847 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 893 912 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149299
Meta Mutation Damage Score 0.1350 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor protein tyrosine kinase and type I transmembrane protein that belongs to the ROR subfamily of cell surface receptors. The protein may be involved in the early formation of the chondrocytes and may be required for cartilage and growth plate development. Mutations in this gene can cause brachydactyly type B, a skeletal disorder characterized by hypoplasia/aplasia of distal phalanges and nails. In addition, mutations in this gene can cause the autosomal recessive form of Robinow syndrome, which is characterized by skeletal dysplasia with generalized limb bone shortening, segmental defects of the spine, brachydactyly, and a dysmorphic facial appearance. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for some disruptions in this gene die within the first few hours after birth. They display respiratory and cardiovascular abnormalities as well as a variety of skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Gulo A G 14: 65,991,028 probably null Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Ror2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ror2 APN 13 53113082 missense probably benign 0.01
IGL01523:Ror2 APN 13 53118963 missense probably benign 0.02
IGL01599:Ror2 APN 13 53111617 missense probably damaging 1.00
IGL01669:Ror2 APN 13 53111088 missense probably damaging 1.00
IGL02016:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02138:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02139:Ror2 APN 13 53111164 missense probably damaging 1.00
IGL02172:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02173:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02176:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02177:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02178:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02179:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02182:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02189:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02190:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02203:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02230:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02231:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02234:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02423:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02424:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02478:Ror2 APN 13 53121667 missense probably damaging 1.00
IGL02479:Ror2 APN 13 53131932 missense possibly damaging 0.62
IGL02517:Ror2 APN 13 53118840 missense probably damaging 1.00
IGL02554:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02618:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02619:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02622:Ror2 APN 13 53110728 missense probably damaging 1.00
IGL02623:Ror2 APN 13 53110728 missense probably damaging 1.00
willowy UTSW 13 53131919 missense probably damaging 1.00
R0076:Ror2 UTSW 13 53113074 missense probably benign 0.02
R0375:Ror2 UTSW 13 53132004 missense probably damaging 1.00
R0826:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R1823:Ror2 UTSW 13 53110305 missense probably benign 0.07
R1895:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1946:Ror2 UTSW 13 53131849 missense probably damaging 1.00
R1983:Ror2 UTSW 13 53110408 missense probably benign 0.01
R2031:Ror2 UTSW 13 53117330 missense probably benign 0.01
R2197:Ror2 UTSW 13 53285780 critical splice donor site probably null
R2246:Ror2 UTSW 13 53111602 missense probably damaging 1.00
R2411:Ror2 UTSW 13 53130944 missense possibly damaging 0.67
R2905:Ror2 UTSW 13 53131995 missense probably benign 0.01
R3156:Ror2 UTSW 13 53117364 missense probably damaging 0.98
R4198:Ror2 UTSW 13 53110644 missense probably benign 0.08
R4408:Ror2 UTSW 13 53118961 missense probably damaging 1.00
R4469:Ror2 UTSW 13 53131980 missense possibly damaging 0.87
R4648:Ror2 UTSW 13 53285500 nonsense probably null
R4705:Ror2 UTSW 13 53117297 missense probably benign 0.00
R4824:Ror2 UTSW 13 53110683 missense probably benign 0.10
R4831:Ror2 UTSW 13 53118844 missense probably damaging 0.97
R4951:Ror2 UTSW 13 53117147 missense probably benign 0.00
R4975:Ror2 UTSW 13 53131918 missense probably damaging 1.00
R5380:Ror2 UTSW 13 53117149 missense possibly damaging 0.73
R5469:Ror2 UTSW 13 53117339 missense probably benign 0.00
R5604:Ror2 UTSW 13 53117165 missense probably benign 0.01
R6188:Ror2 UTSW 13 53111311 missense probably damaging 0.98
R6221:Ror2 UTSW 13 53113217 missense probably damaging 1.00
R6243:Ror2 UTSW 13 53113080 missense probably benign
R6255:Ror2 UTSW 13 53110542 missense probably damaging 1.00
R6497:Ror2 UTSW 13 53131919 missense probably damaging 1.00
R6717:Ror2 UTSW 13 53118982 missense probably damaging 1.00
R6918:Ror2 UTSW 13 53111451 missense probably damaging 0.96
R7092:Ror2 UTSW 13 53110236 missense probably benign
R7134:Ror2 UTSW 13 53146706 missense probably benign 0.00
R7254:Ror2 UTSW 13 53118720 missense possibly damaging 0.72
R7517:Ror2 UTSW 13 53110865 missense possibly damaging 0.86
R7560:Ror2 UTSW 13 53110813 missense probably benign 0.05
R7746:Ror2 UTSW 13 53117225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTAAATGCCTGTTCAGCTGGG -3'
(R):5'- AGCCAGCTTTAATGAGCAAAACAG -3'

Sequencing Primer
(F):5'- TGTTCAGCTGGGCTCCC -3'
(R):5'- TACAGTTTAGATGAGGAACGAGC -3'
Posted On2014-11-11