Incidental Mutation 'R2405:Gulo'
ID247979
Institutional Source Beutler Lab
Gene Symbol Gulo
Ensembl Gene ENSMUSG00000034450
Gene Namegulonolactone (L-) oxidase
SynonymsL-gulono-gamma-lactone oxidase, sfx
MMRRC Submission 040371-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R2405 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location65986786-66009207 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 65991028 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000060912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059970] [ENSMUST00000059970]
Predicted Effect probably null
Transcript: ENSMUST00000059970
SMART Domains Protein: ENSMUSP00000060912
Gene: ENSMUSG00000034450

DomainStartEndE-ValueType
Pfam:FAD_binding_4 21 156 7.6e-36 PFAM
Pfam:ALO 180 438 2.8e-92 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000059970
SMART Domains Protein: ENSMUSP00000060912
Gene: ENSMUSG00000034450

DomainStartEndE-ValueType
Pfam:FAD_binding_4 21 156 7.6e-36 PFAM
Pfam:ALO 180 438 2.8e-92 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for spontaneous mutations exhibit impaired growth and mobility, decreased spleen and thymus weights, reduced serum calcium, phosphate, alkaline phosphatase, IGF1, and osteocalcin levels, and small, fragile and histologically abnormal bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
9030624J02Rik G C 7: 118,792,595 A410P probably damaging Het
Abl1 T C 2: 31,800,974 L835P possibly damaging Het
Ascc3 T A 10: 50,731,678 V1426D probably damaging Het
Ccny A G 18: 9,353,480 Y98H probably benign Het
Ccser2 G A 14: 36,938,669 T509M probably damaging Het
Crnkl1 A T 2: 145,928,157 Y255* probably null Het
Cyp2d11 C T 15: 82,389,266 S468N possibly damaging Het
Dnah7b C A 1: 46,362,954 T3983N probably benign Het
Ebf1 T A 11: 44,991,522 M427K probably damaging Het
Fxr1 T A 3: 34,061,854 S438T probably damaging Het
Gabrr1 A T 4: 33,157,110 D209V probably damaging Het
Gbx2 G T 1: 89,930,908 probably benign Het
Gm5741 A G 8: 85,067,641 I56T possibly damaging Het
Gm884 T C 11: 103,620,984 M53V unknown Het
Hhla1 A T 15: 65,936,311 L295* probably null Het
Hmcn1 T A 1: 150,860,341 I126L probably damaging Het
Hpse A G 5: 100,708,771 S121P possibly damaging Het
Inpp5d A G 1: 87,699,729 H321R possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kdm5b T A 1: 134,609,016 M658K probably damaging Het
Kidins220 A T 12: 25,011,509 E875V probably damaging Het
Nlrp4b A G 7: 10,714,728 E286G probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Pde3a A T 6: 141,481,242 I710F probably damaging Het
Phb T C 11: 95,675,268 I126T probably benign Het
Ppp4r1 C T 17: 65,811,346 T164I possibly damaging Het
Psmc1 G A 12: 100,120,103 R333Q probably benign Het
Pygb A G 2: 150,820,775 Y554C probably benign Het
Ror2 G A 13: 53,130,944 P144L possibly damaging Het
Serpina3a A T 12: 104,121,318 M357L possibly damaging Het
Serpinb9e T A 13: 33,260,080 M361K probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc15a2 G A 16: 36,751,837 Q691* probably null Het
Slc25a25 C T 2: 32,417,719 probably null Het
Slc34a2 A G 5: 53,058,181 N9S probably benign Het
Slc4a2 A G 5: 24,435,601 T665A probably damaging Het
Spef2 C A 15: 9,626,034 E1149* probably null Het
Tmem179 A G 12: 112,501,913 W45R probably damaging Het
Tmpo C A 10: 91,163,354 K190N probably damaging Het
Triml1 T C 8: 43,130,283 Y427C probably damaging Het
Trpm2 A G 10: 77,934,724 L720P probably damaging Het
Vmn1r60 A G 7: 5,544,913 Y63H probably benign Het
Vmn2r96 T A 17: 18,597,840 C560S probably damaging Het
Zdhhc13 A G 7: 48,822,730 probably null Het
Other mutations in Gulo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Gulo APN 14 66005949 missense probably damaging 1.00
IGL01736:Gulo APN 14 65996876 missense probably benign 0.24
R0599:Gulo UTSW 14 65990441 missense probably damaging 1.00
R2014:Gulo UTSW 14 66009047 start codon destroyed probably benign
R2058:Gulo UTSW 14 65991159 missense possibly damaging 0.51
R2079:Gulo UTSW 14 65990383 missense probably damaging 1.00
R4196:Gulo UTSW 14 65988253 missense possibly damaging 0.49
R4807:Gulo UTSW 14 65990384 missense probably benign 0.00
R5341:Gulo UTSW 14 65988258 missense probably benign 0.12
R5913:Gulo UTSW 14 66000021 critical splice acceptor site probably null
R5915:Gulo UTSW 14 66008121 missense probably benign 0.29
R6328:Gulo UTSW 14 66002631 missense probably damaging 1.00
R6628:Gulo UTSW 14 66004170 missense probably benign 0.00
R7725:Gulo UTSW 14 66008073 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCCTATCTTGGGAAGGTCTTAC -3'
(R):5'- GCTGACACGGTAAATGCTG -3'

Sequencing Primer
(F):5'- AGACAGGGTTTCTCTGTATAGCCC -3'
(R):5'- GTAAATGCTGGGCCCCCTAAC -3'
Posted On2014-11-11