Incidental Mutation 'R0299:Plxnc1'
ID24799
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Nameplexin C1
SynonymsCD232, vespr, 2510048K12Rik
MMRRC Submission 038513-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R0299 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location94790866-94944835 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 94849821 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337] [ENSMUST00000099337]
Predicted Effect probably null
Transcript: ENSMUST00000099337
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000099337
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000181244
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
4933427I04Rik A T 4: 123,860,822 R176S possibly damaging Het
A2ml1 T G 6: 128,553,232 probably benign Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Clec2h T C 6: 128,670,895 V69A probably damaging Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 130,058,318 probably null Het
Degs1 A T 1: 182,279,271 I141N probably damaging Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dock10 T C 1: 80,536,929 R1424G probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Frk T C 10: 34,484,371 probably null Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gm11596 G A 11: 99,792,944 P117S unknown Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Hps6 G A 19: 46,004,232 V203M probably damaging Het
Hsd17b7 G A 1: 169,959,794 probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mecom A G 3: 29,980,411 L372P probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc2 C T 7: 141,752,729 T296I probably damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Olfr1331 A G 4: 118,869,416 I212V probably benign Het
Olfr1338 A T 4: 118,754,535 M1K probably null Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Pelo A T 13: 115,088,903 C40* probably null Het
Ptpru G A 4: 131,803,387 Q519* probably null Het
Pzp A G 6: 128,495,330 probably benign Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shtn1 T C 19: 59,018,951 E289G probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Sppl3 T A 5: 115,088,994 probably benign Het
Suco G A 1: 161,853,810 T253I probably benign Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tram2 T C 1: 21,004,244 D238G probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Trub1 A G 19: 57,483,625 T178A possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Zfp821 G T 8: 109,724,230 R285L probably damaging Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 splice site probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94831333 splice site probably benign
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94844179 splice site probably null
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94852622 missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 splice site probably null
R4004:Plxnc1 UTSW 10 94794597 nonsense probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94864774 missense probably benign
R5826:Plxnc1 UTSW 10 94799473 critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94793290 missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R8103:Plxnc1 UTSW 10 94871082 missense probably benign
R8226:Plxnc1 UTSW 10 94833368 missense possibly damaging 0.90
R8273:Plxnc1 UTSW 10 94813243 missense probably benign 0.14
R8299:Plxnc1 UTSW 10 94827179 missense probably benign 0.35
R8392:Plxnc1 UTSW 10 94801490 missense possibly damaging 0.75
R8758:Plxnc1 UTSW 10 94922745 missense possibly damaging 0.91
R8806:Plxnc1 UTSW 10 94799278 missense probably damaging 1.00
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94865029 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTTACATCACGAATGGGGAAGGCAG -3'
(R):5'- GGGTCGTCACCTTGAGCAATCAAC -3'

Sequencing Primer
(F):5'- gctgtgagtttcctagtagcc -3'
(R):5'- GCAATCAACTGTGCTAAGTGTCTG -3'
Posted On2013-04-16