Incidental Mutation 'R2406:Eif4ebp1'
ID248009
Institutional Source Beutler Lab
Gene Symbol Eif4ebp1
Ensembl Gene ENSMUSG00000031490
Gene Nameeukaryotic translation initiation factor 4E binding protein 1
Synonyms4e-bp1, PHAS-I
MMRRC Submission 040372-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R2406 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location27260329-27276674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 27273334 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 52 (I52V)
Ref Sequence ENSEMBL: ENSMUSP00000033880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033880]
Predicted Effect probably damaging
Transcript: ENSMUST00000033880
AA Change: I52V

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033880
Gene: ENSMUSG00000031490
AA Change: I52V

DomainStartEndE-ValueType
Pfam:eIF_4EBP 1 117 2.4e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210959
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency 95% (42/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one member of a family of translation repressor proteins. The protein directly interacts with eukaryotic translation initiation factor 4E (eIF4E), which is a limiting component of the multisubunit complex that recruits 40S ribosomal subunits to the 5' end of mRNAs. Interaction of this protein with eIF4E inhibits complex assembly and represses translation. This protein is phosphorylated in response to various signals including UV irradiation and insulin signaling, resulting in its dissociation from eIF4E and activation of mRNA translation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation display hypoglycemia and hypoleptinemia with significantly reduced white fat pads and a notable increase in metabolic rate. Male white adipose tissue exhibits the multilocular appearance of brown adipocytes, and expresses UCP1, a specific marker of brown fat. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2300002M23Rik T A 17: 35,568,455 V230E probably damaging Het
Adam22 A T 5: 8,180,064 probably benign Het
AW554918 A G 18: 25,340,287 I180V possibly damaging Het
C9 T C 15: 6,483,299 S301P possibly damaging Het
Cdc42bpb T C 12: 111,302,124 Q1214R probably benign Het
Chaf1b T C 16: 93,900,155 I351T probably damaging Het
Clip1 T C 5: 123,603,660 E1177G probably damaging Het
Colgalt1 G A 8: 71,617,668 C198Y probably damaging Het
Dennd4b C T 3: 90,275,488 R871C probably damaging Het
Fam205a1 A T 4: 42,851,696 D153E probably benign Het
Fbxw5 T C 2: 25,504,183 I86T probably damaging Het
Gm10650 A G 3: 128,039,881 noncoding transcript Het
Gm11639 A T 11: 104,720,631 D433V probably benign Het
Helz G A 11: 107,686,552 A1910T unknown Het
Hsf2 C T 10: 57,497,546 T70I probably damaging Het
Ifih1 A G 2: 62,607,103 probably benign Het
Kdm2a T C 19: 4,322,518 D933G probably damaging Het
Macc1 T C 12: 119,465,611 I832T probably damaging Het
Mapk15 T C 15: 75,998,848 S512P possibly damaging Het
Mybpc2 A T 7: 44,521,725 I134N possibly damaging Het
Myh4 A G 11: 67,259,174 E1853G probably damaging Het
Ncoa3 T C 2: 166,055,359 V690A probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr1447 A G 19: 12,901,627 V51A probably benign Het
Pacsin2 A T 15: 83,385,112 probably benign Het
Piezo2 A T 18: 63,022,525 L2416Q probably damaging Het
Pip5k1c T A 10: 81,309,024 I233N probably damaging Het
Ptcd3 T C 6: 71,888,647 D428G probably damaging Het
Ptprf T C 4: 118,269,304 D84G possibly damaging Het
Rasgrf2 T C 13: 91,972,240 D798G probably benign Het
Setd7 A G 3: 51,542,676 Y110H probably damaging Het
Sgta T C 10: 81,051,247 I61M possibly damaging Het
Shank1 A G 7: 44,356,952 D2031G possibly damaging Het
Skint5 A G 4: 113,942,667 Y88H probably damaging Het
Stox1 T C 10: 62,664,166 I872V probably benign Het
Tmc4 A G 7: 3,671,026 F385L probably benign Het
Top3a A G 11: 60,756,012 F258L probably damaging Het
Ttn T C 2: 76,950,155 Y1084C probably damaging Het
Ubtf A T 11: 102,308,702 Y504* probably null Het
Wdfy3 T C 5: 101,888,259 T2098A probably damaging Het
Wnk2 G T 13: 49,061,488 T1194K possibly damaging Het
Zbtb40 T A 4: 136,998,568 E560V probably benign Het
Other mutations in Eif4ebp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Eif4ebp1 APN 8 27273482 missense possibly damaging 0.54
R1977:Eif4ebp1 UTSW 8 27275101 missense probably damaging 1.00
R2070:Eif4ebp1 UTSW 8 27273344 missense probably damaging 1.00
R7011:Eif4ebp1 UTSW 8 27273344 missense probably damaging 1.00
R7124:Eif4ebp1 UTSW 8 27273419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTTAGTGGGCAACAAAC -3'
(R):5'- TCCTTCCAGTTCAGGACCTG -3'

Sequencing Primer
(F):5'- TCTTAGTGGGCAACAAACACCTC -3'
(R):5'- TGGACAGGACTCACCGC -3'
Posted On2014-11-11