Incidental Mutation 'R0299:Arg2'
ID24802
Institutional Source Beutler Lab
Gene Symbol Arg2
Ensembl Gene ENSMUSG00000021125
Gene Namearginase type II
SynonymsAII
MMRRC Submission 038513-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0299 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location79130777-79156301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79147612 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 70 (D70G)
Ref Sequence ENSEMBL: ENSMUSP00000021550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021550]
Predicted Effect probably damaging
Transcript: ENSMUST00000021550
AA Change: D70G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021550
Gene: ENSMUSG00000021125
AA Change: D70G

DomainStartEndE-ValueType
Pfam:Arginase 24 324 7.4e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218917
Meta Mutation Damage Score 0.2586 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exists (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type II isoform encoded by this gene, is located in the mitochondria and expressed in extra-hepatic tissues, especially kidney. The physiologic role of this isoform is poorly understood; it is thought to play a role in nitric oxide and polyamine metabolism. Transcript variants of the type II gene resulting from the use of alternative polyadenylation sites have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in elevated plasma arginine concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
4933427I04Rik A T 4: 123,860,822 R176S possibly damaging Het
A2ml1 T G 6: 128,553,232 probably benign Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Adcy8 T A 15: 64,716,166 D894V probably damaging Het
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Clec2h T C 6: 128,670,895 V69A probably damaging Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 130,058,318 probably null Het
Degs1 A T 1: 182,279,271 I141N probably damaging Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dock10 T C 1: 80,536,929 R1424G probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Frk T C 10: 34,484,371 probably null Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gm11596 G A 11: 99,792,944 P117S unknown Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Hps6 G A 19: 46,004,232 V203M probably damaging Het
Hsd17b7 G A 1: 169,959,794 probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mecom A G 3: 29,980,411 L372P probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc2 C T 7: 141,752,729 T296I probably damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Olfr1331 A G 4: 118,869,416 I212V probably benign Het
Olfr1338 A T 4: 118,754,535 M1K probably null Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Pelo A T 13: 115,088,903 C40* probably null Het
Plxnc1 C T 10: 94,849,821 probably null Het
Ptpru G A 4: 131,803,387 Q519* probably null Het
Pzp A G 6: 128,495,330 probably benign Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shtn1 T C 19: 59,018,951 E289G probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Sppl3 T A 5: 115,088,994 probably benign Het
Suco G A 1: 161,853,810 T253I probably benign Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tram2 T C 1: 21,004,244 D238G probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Trub1 A G 19: 57,483,625 T178A possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Zfp821 G T 8: 109,724,230 R285L probably damaging Het
Other mutations in Arg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Arg2 APN 12 79149859 splice site probably benign
IGL02494:Arg2 APN 12 79151923 missense probably benign 0.00
IGL02512:Arg2 APN 12 79147743 missense probably benign 0.01
IGL02543:Arg2 APN 12 79150759 missense probably benign 0.02
IGL02974:Arg2 APN 12 79150792 missense probably damaging 1.00
IGL03106:Arg2 APN 12 79149891 missense probably damaging 0.99
IGL03240:Arg2 APN 12 79131831 splice site probably null
R0119:Arg2 UTSW 12 79147612 missense probably damaging 1.00
R0136:Arg2 UTSW 12 79150006 missense probably damaging 1.00
R1856:Arg2 UTSW 12 79147662 missense probably benign
R1863:Arg2 UTSW 12 79150020 nonsense probably null
R4369:Arg2 UTSW 12 79149972 missense probably damaging 0.99
R4901:Arg2 UTSW 12 79147711 missense probably damaging 1.00
R7251:Arg2 UTSW 12 79150798 missense probably damaging 0.99
R8683:Arg2 UTSW 12 79150020 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTGGAACTGTGGTCGGACAAAATG -3'
(R):5'- AGAACCTTGCTTAGTCTACCCCTGC -3'

Sequencing Primer
(F):5'- CTGTGGTCGGACAAAATGAGTATG -3'
(R):5'- TTCCTCCACGTAAGGACACTG -3'
Posted On2013-04-16