Incidental Mutation 'R2407:Cd1d1'
ID248044
Institutional Source Beutler Lab
Gene Symbol Cd1d1
Ensembl Gene ENSMUSG00000028076
Gene NameCD1d1 antigen
SynonymsCD1.1, Cd1d, Cd1a, Ly-38
MMRRC Submission 040373-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R2407 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location86995834-86999441 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86998182 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 168 (L168P)
Ref Sequence ENSEMBL: ENSMUSP00000029717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029717] [ENSMUST00000063869]
Predicted Effect probably damaging
Transcript: ENSMUST00000029717
AA Change: L168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029717
Gene: ENSMUSG00000028076
AA Change: L168P

DomainStartEndE-ValueType
Pfam:MHC_I_3 1 200 1.3e-95 PFAM
IGc1 221 291 5.35e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063869
SMART Domains Protein: ENSMUSP00000070616
Gene: ENSMUSG00000028076

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PDB:4MQ7|A 23 73 2e-15 PDB
IGc1 90 160 5.35e-22 SMART
low complexity region 173 194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107620
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142793
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a divergent member of the CD1 family of transmembrane glycoproteins, which are structurally related to the major histocompatibility complex (MHC) proteins and form heterodimers with beta-2-microglobulin. The CD1 proteins mediate the presentation of primarily lipid and glycolipid antigens of self or microbial origin to T cells. The human genome contains five CD1 family genes organized in a cluster on chromosome 1. The CD1 family members are thought to differ in their cellular localization and specificity for particular lipid ligands. The protein encoded by this gene localizes to late endosomes and lysosomes via a tyrosine-based motif in the cytoplasmic tail. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for targeted null mutations lack natural killer T cells, and mutant splenocytes fail to produce interleukin 4 (IL4). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,228 N149I probably benign Het
4931408C20Rik A T 1: 26,682,838 M1087K possibly damaging Het
Agxt G T 1: 93,135,780 A135S probably benign Het
Aldh1a2 A T 9: 71,252,598 I40F probably damaging Het
Ang T A 14: 51,101,646 C81* probably null Het
Apc G T 18: 34,314,262 V1370F possibly damaging Het
Arfgef3 T C 10: 18,677,866 T127A possibly damaging Het
Epb42 C A 2: 121,024,752 V451F probably damaging Het
F5 T A 1: 164,211,872 L2017Q probably damaging Het
Hmcn2 A T 2: 31,335,412 probably null Het
Kif13a G A 13: 46,777,097 P164S probably damaging Het
Kirrel T A 3: 87,084,843 I593F probably benign Het
Lin28b A T 10: 45,381,087 I265N possibly damaging Het
Mctp2 A T 7: 72,200,407 D507E probably benign Het
Morc3 G A 16: 93,844,327 probably null Het
Myo3b T C 2: 70,255,253 Y750H probably damaging Het
Nrp1 T C 8: 128,431,945 S238P probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Otog A G 7: 46,241,540 E41G probably benign Het
Pclo G T 5: 14,678,932 probably benign Het
Pdzd2 T C 15: 12,373,161 D2296G probably damaging Het
Peak1 A G 9: 56,259,226 C473R probably damaging Het
Rad51ap2 T A 12: 11,458,501 M808K probably damaging Het
Sec24b A C 3: 130,002,316 S651A probably benign Het
Slc17a3 G A 13: 23,852,435 probably null Het
Slc4a10 A G 2: 62,313,343 H1074R probably benign Het
Spata31d1b A G 13: 59,716,846 K603E possibly damaging Het
Sptbn4 T A 7: 27,418,098 K409* probably null Het
Tacc2 G A 7: 130,622,040 V152I possibly damaging Het
Tiam2 A G 17: 3,477,261 M65V probably benign Het
Tmem131l G T 3: 83,922,048 Q1100K probably benign Het
Togaram1 T C 12: 64,967,670 M565T probably damaging Het
Trib1 T C 15: 59,654,600 Y340H probably benign Het
Wdr66 A T 5: 123,289,969 M510L probably benign Het
Wdr7 A T 18: 63,760,723 M643L probably benign Het
Zfp51 A T 17: 21,463,831 H236L probably damaging Het
Other mutations in Cd1d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Cd1d1 APN 3 86998173 missense probably damaging 0.99
IGL01811:Cd1d1 APN 3 86996588 missense possibly damaging 0.86
IGL02371:Cd1d1 APN 3 86998881 missense probably benign 0.40
IGL03001:Cd1d1 APN 3 86998161 missense probably benign
R0350:Cd1d1 UTSW 3 86997573 missense probably benign 0.11
R1771:Cd1d1 UTSW 3 86998665 missense possibly damaging 0.85
R3906:Cd1d1 UTSW 3 86998756 missense probably damaging 1.00
R4540:Cd1d1 UTSW 3 86996705 missense probably benign 0.21
R4976:Cd1d1 UTSW 3 86998651 missense probably benign 0.00
R5303:Cd1d1 UTSW 3 86998120 missense probably benign 0.22
R5786:Cd1d1 UTSW 3 86998788 missense probably benign 0.17
R6088:Cd1d1 UTSW 3 86998702 missense probably benign 0.07
R6273:Cd1d1 UTSW 3 86998257 missense probably benign 0.00
R7315:Cd1d1 UTSW 3 86998113 missense possibly damaging 0.80
R7787:Cd1d1 UTSW 3 86997596 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTGTCAGTGAGAAAATAAACCCC -3'
(R):5'- TCCCATTGAGATCCAGCTGTC -3'

Sequencing Primer
(F):5'- CCTCTACAGCTGACAGTGATG -3'
(R):5'- CTGCGGGCTGTGAAATGTACC -3'
Posted On2014-11-11