Mutagenetix > Incidental Mutation

Incidental Mutation 'R2407:Sptbn4'

248053

Institutional Source

Beutler Lab

Gene Symbol

Sptbn4

Ensembl Gene

ENSMUSG00000011751

Gene Name

spectrin beta, non-erythrocytic 4

Synonyms

nmf261, 1700022P15Rik, SpbIV, ROSA62, 5830426A08Rik, dyn, neuroaxonal dystrophy, Spnb4

MMRRC Submission

040373-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.379) question?

Stock #

R2407 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

27055808-27147111 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 27117523 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 409 (K409*)

Ref Sequence

ENSEMBL: ENSMUSP00000132807 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000172269]

AlphaFold

E9PX29

Predicted Effect

probably null
Transcript: ENSMUST00000011895
AA Change: K409*

SMART Domains

Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: K409*

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.4e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	642	7.62e-19	SMART
SPEC	648	766	1.31e-8	SMART
SPEC	772	874	2.94e-11	SMART
SPEC	880	980	1.49e-21	SMART
SPEC	986	1081	1.65e0	SMART
SPEC	1087	1192	2.82e-13	SMART
SPEC	1198	1298	6.59e-14	SMART
SPEC	1304	1403	4.08e-19	SMART
SPEC	1409	1508	5.92e-7	SMART
SPEC	1514	1614	2.45e-22	SMART
SPEC	1620	1720	1.45e-24	SMART
SPEC	1726	1827	1.86e-22	SMART
SPEC	1833	1935	9.54e-11	SMART
SPEC	1941	2041	1.35e-19	SMART
SPEC	2047	2297	1.06e-8	SMART
low complexity region	2358	2412	N/A	INTRINSIC
PH	2416	2526	1.54e-14	SMART
low complexity region	2549	2560	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172269
AA Change: K409*

SMART Domains

Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: K409*

Domain	Start	End	E-Value	Type
low complexity region	39	45	N/A	INTRINSIC
CH	64	164	8.03e-24	SMART
CH	183	281	7.38e-23	SMART
Pfam:Spectrin	310	420	1.9e-10	PFAM
SPEC	433	533	5.22e-26	SMART
SPEC	539	637	3.45e-17	SMART
SPEC	643	761	1.31e-8	SMART
SPEC	767	869	2.94e-11	SMART
SPEC	875	975	1.49e-21	SMART
SPEC	981	1076	1.65e0	SMART
SPEC	1082	1187	2.82e-13	SMART
SPEC	1193	1293	6.59e-14	SMART
SPEC	1299	1398	4.08e-19	SMART
SPEC	1404	1503	5.92e-7	SMART
SPEC	1509	1609	2.45e-22	SMART
SPEC	1615	1715	1.45e-24	SMART
SPEC	1721	1822	1.86e-22	SMART
SPEC	1828	1930	9.54e-11	SMART
SPEC	1936	2036	1.35e-19	SMART
SPEC	2042	2292	1.06e-8	SMART
low complexity region	2352	2406	N/A	INTRINSIC
PH	2410	2520	1.54e-14	SMART
low complexity region	2543	2554	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.8%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	A	T	6: 65,930,212 (GRCm39)	N149I	probably benign	Het
Agxt	G	T	1: 93,063,502 (GRCm39)	A135S	probably benign	Het
Aldh1a2	A	T	9: 71,159,880 (GRCm39)	I40F	probably damaging	Het
Ang	T	A	14: 51,339,103 (GRCm39)	C81*	probably null	Het
Apc	G	T	18: 34,447,315 (GRCm39)	V1370F	possibly damaging	Het
Arfgef3	T	C	10: 18,553,614 (GRCm39)	T127A	possibly damaging	Het
Cd1d1	A	G	3: 86,905,489 (GRCm39)	L168P	probably damaging	Het
Cfap251	A	T	5: 123,428,032 (GRCm39)	M510L	probably benign	Het
Epb42	C	A	2: 120,855,233 (GRCm39)	V451F	probably damaging	Het
F5	T	A	1: 164,039,441 (GRCm39)	L2017Q	probably damaging	Het
Hmcn2	A	T	2: 31,225,424 (GRCm39)		probably null	Het
Kif13a	G	A	13: 46,930,573 (GRCm39)	P164S	probably damaging	Het
Kirrel1	T	A	3: 86,992,150 (GRCm39)	I593F	probably benign	Het
Lin28b	A	T	10: 45,257,183 (GRCm39)	I265N	possibly damaging	Het
Mctp2	A	T	7: 71,850,155 (GRCm39)	D507E	probably benign	Het
Morc3	G	A	16: 93,641,215 (GRCm39)		probably null	Het
Myo3b	T	C	2: 70,085,597 (GRCm39)	Y750H	probably damaging	Het
Nrp1	T	C	8: 129,158,426 (GRCm39)	S238P	probably damaging	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Otog	A	G	7: 45,890,964 (GRCm39)	E41G	probably benign	Het
Pclo	G	T	5: 14,728,946 (GRCm39)		probably benign	Het
Pdzd2	T	C	15: 12,373,247 (GRCm39)	D2296G	probably damaging	Het
Peak1	A	G	9: 56,166,510 (GRCm39)	C473R	probably damaging	Het
Rad51ap2	T	A	12: 11,508,502 (GRCm39)	M808K	probably damaging	Het
Sec24b	A	C	3: 129,795,965 (GRCm39)	S651A	probably benign	Het
Slc17a3	G	A	13: 24,036,418 (GRCm39)		probably null	Het
Slc4a10	A	G	2: 62,143,687 (GRCm39)	H1074R	probably benign	Het
Spata31d1b	A	G	13: 59,864,660 (GRCm39)	K603E	possibly damaging	Het
Spata31e2	A	T	1: 26,721,919 (GRCm39)	M1087K	possibly damaging	Het
Tacc2	G	A	7: 130,223,770 (GRCm39)	V152I	possibly damaging	Het
Tiam2	A	G	17: 3,527,536 (GRCm39)	M65V	probably benign	Het
Tmem131l	G	T	3: 83,829,355 (GRCm39)	Q1100K	probably benign	Het
Togaram1	T	C	12: 65,014,444 (GRCm39)	M565T	probably damaging	Het
Trib1	T	C	15: 59,526,449 (GRCm39)	Y340H	probably benign	Het
Wdr7	A	T	18: 63,893,794 (GRCm39)	M643L	probably benign	Het
Zfp51	A	T	17: 21,684,093 (GRCm39)	H236L	probably damaging	Het

Other mutations in Sptbn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sptbn4	APN	7	27,068,859 (GRCm39)	missense	probably damaging	1.00
IGL00468:Sptbn4	APN	7	27,117,390 (GRCm39)	missense	probably damaging	1.00
IGL01396:Sptbn4	APN	7	27,114,196 (GRCm39)	missense	probably benign	0.06
IGL01700:Sptbn4	APN	7	27,103,693 (GRCm39)	missense	probably damaging	1.00
IGL01878:Sptbn4	APN	7	27,063,571 (GRCm39)	missense	probably damaging	0.99
IGL02066:Sptbn4	APN	7	27,063,940 (GRCm39)	missense	possibly damaging	0.68
IGL02116:Sptbn4	APN	7	27,063,782 (GRCm39)	missense	probably benign
IGL02226:Sptbn4	APN	7	27,065,132 (GRCm39)	missense	probably damaging	1.00
IGL02333:Sptbn4	APN	7	27,063,724 (GRCm39)	missense	probably damaging	1.00
IGL02337:Sptbn4	APN	7	27,127,672 (GRCm39)	missense	probably benign	0.03
IGL02451:Sptbn4	APN	7	27,065,014 (GRCm39)	missense	probably null	0.15
IGL02487:Sptbn4	APN	7	27,118,522 (GRCm39)	missense	probably damaging	1.00
IGL02530:Sptbn4	APN	7	27,090,976 (GRCm39)	missense	probably damaging	1.00
IGL02724:Sptbn4	APN	7	27,067,104 (GRCm39)	missense	probably damaging	1.00
IGL02850:Sptbn4	APN	7	27,126,258 (GRCm39)	missense	possibly damaging	0.95
IGL02851:Sptbn4	APN	7	27,126,258 (GRCm39)	missense	possibly damaging	0.95
IGL02869:Sptbn4	APN	7	27,093,573 (GRCm39)	splice site	probably benign
IGL02961:Sptbn4	APN	7	27,097,392 (GRCm39)	missense	probably damaging	1.00
ANU22:Sptbn4	UTSW	7	27,056,812 (GRCm39)	nonsense	probably null
R0194:Sptbn4	UTSW	7	27,104,336 (GRCm39)	missense	probably benign	0.00
R0328:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	1.00
R0379:Sptbn4	UTSW	7	27,059,161 (GRCm39)	splice site	probably benign
R0510:Sptbn4	UTSW	7	27,060,991 (GRCm39)	critical splice donor site	probably null
R0550:Sptbn4	UTSW	7	27,063,803 (GRCm39)	missense	probably benign	0.16
R0557:Sptbn4	UTSW	7	27,107,753 (GRCm39)	nonsense	probably null
R1336:Sptbn4	UTSW	7	27,117,388 (GRCm39)	missense	probably damaging	1.00
R1494:Sptbn4	UTSW	7	27,133,719 (GRCm39)	missense	probably damaging	1.00
R1630:Sptbn4	UTSW	7	27,118,164 (GRCm39)	missense	probably benign	0.09
R1803:Sptbn4	UTSW	7	27,118,008 (GRCm39)	missense	probably damaging	1.00
R1834:Sptbn4	UTSW	7	27,066,071 (GRCm39)	missense	probably null	0.96
R1906:Sptbn4	UTSW	7	27,090,856 (GRCm39)	critical splice donor site	probably null
R1924:Sptbn4	UTSW	7	27,106,563 (GRCm39)	missense	probably damaging	1.00
R1951:Sptbn4	UTSW	7	27,065,868 (GRCm39)	missense	possibly damaging	0.64
R1989:Sptbn4	UTSW	7	27,067,127 (GRCm39)	missense	probably damaging	1.00
R1990:Sptbn4	UTSW	7	27,123,235 (GRCm39)	missense	probably benign	0.19
R2005:Sptbn4	UTSW	7	27,065,844 (GRCm39)	nonsense	probably null
R2083:Sptbn4	UTSW	7	27,127,681 (GRCm39)	missense	probably benign	0.29
R2176:Sptbn4	UTSW	7	27,063,587 (GRCm39)	missense	probably benign	0.21
R2211:Sptbn4	UTSW	7	27,067,034 (GRCm39)	missense	probably damaging	1.00
R2262:Sptbn4	UTSW	7	27,133,782 (GRCm39)	missense	probably damaging	1.00
R2263:Sptbn4	UTSW	7	27,133,782 (GRCm39)	missense	probably damaging	1.00
R2374:Sptbn4	UTSW	7	27,059,517 (GRCm39)	missense	probably damaging	0.99
R4115:Sptbn4	UTSW	7	27,090,995 (GRCm39)	missense	probably damaging	1.00
R4116:Sptbn4	UTSW	7	27,090,995 (GRCm39)	missense	probably damaging	1.00
R4392:Sptbn4	UTSW	7	27,117,896 (GRCm39)	missense	probably damaging	0.97
R4426:Sptbn4	UTSW	7	27,123,223 (GRCm39)	missense	probably damaging	1.00
R4535:Sptbn4	UTSW	7	27,067,127 (GRCm39)	missense	probably damaging	1.00
R4684:Sptbn4	UTSW	7	27,066,160 (GRCm39)	missense	possibly damaging	0.60
R4684:Sptbn4	UTSW	7	27,063,844 (GRCm39)	missense	probably damaging	0.96
R4707:Sptbn4	UTSW	7	27,116,431 (GRCm39)	missense	probably benign	0.12
R4876:Sptbn4	UTSW	7	27,071,577 (GRCm39)	missense	probably damaging	1.00
R5091:Sptbn4	UTSW	7	27,068,816 (GRCm39)	missense	probably damaging	1.00
R5371:Sptbn4	UTSW	7	27,059,166 (GRCm39)	critical splice donor site	probably null
R5790:Sptbn4	UTSW	7	27,065,853 (GRCm39)	missense	probably damaging	0.99
R5857:Sptbn4	UTSW	7	27,118,138 (GRCm39)	missense	possibly damaging	0.89
R5908:Sptbn4	UTSW	7	27,103,678 (GRCm39)	missense	probably benign	0.00
R5980:Sptbn4	UTSW	7	27,071,596 (GRCm39)	missense	probably damaging	1.00
R6005:Sptbn4	UTSW	7	27,118,024 (GRCm39)	missense	probably damaging	1.00
R6013:Sptbn4	UTSW	7	27,063,904 (GRCm39)	missense	probably damaging	0.99
R6037:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	0.97
R6037:Sptbn4	UTSW	7	27,063,595 (GRCm39)	missense	probably damaging	0.97
R6129:Sptbn4	UTSW	7	27,059,513 (GRCm39)	missense	probably damaging	0.98
R6146:Sptbn4	UTSW	7	27,064,012 (GRCm39)	nonsense	probably null
R6762:Sptbn4	UTSW	7	27,093,633 (GRCm39)	missense	probably damaging	1.00
R6897:Sptbn4	UTSW	7	27,071,375 (GRCm39)	missense	possibly damaging	0.96
R7178:Sptbn4	UTSW	7	27,117,481 (GRCm39)	missense	probably damaging	1.00
R7212:Sptbn4	UTSW	7	27,116,210 (GRCm39)	missense	probably benign	0.44
R7465:Sptbn4	UTSW	7	27,066,114 (GRCm39)	missense	probably benign	0.00
R7471:Sptbn4	UTSW	7	27,108,439 (GRCm39)	missense	possibly damaging	0.64
R7510:Sptbn4	UTSW	7	27,127,693 (GRCm39)	missense	probably benign	0.13
R7527:Sptbn4	UTSW	7	27,075,015 (GRCm39)	missense	possibly damaging	0.94
R7528:Sptbn4	UTSW	7	27,141,960 (GRCm39)	missense	probably benign	0.00
R7572:Sptbn4	UTSW	7	27,071,697 (GRCm39)	missense	probably damaging	0.99
R7649:Sptbn4	UTSW	7	27,061,002 (GRCm39)	missense	possibly damaging	0.80
R7714:Sptbn4	UTSW	7	27,063,761 (GRCm39)	missense	probably benign	0.02
R7780:Sptbn4	UTSW	7	27,061,059 (GRCm39)	missense	possibly damaging	0.70
R7854:Sptbn4	UTSW	7	27,061,835 (GRCm39)	missense	probably benign
R8002:Sptbn4	UTSW	7	27,117,417 (GRCm39)	missense	possibly damaging	0.91
R8058:Sptbn4	UTSW	7	27,063,694 (GRCm39)	missense	possibly damaging	0.92
R8181:Sptbn4	UTSW	7	27,074,808 (GRCm39)	missense	possibly damaging	0.79
R8195:Sptbn4	UTSW	7	27,108,314 (GRCm39)	nonsense	probably null
R8353:Sptbn4	UTSW	7	27,103,663 (GRCm39)	missense	probably damaging	1.00
R8392:Sptbn4	UTSW	7	27,071,721 (GRCm39)	missense	probably damaging	1.00
R8453:Sptbn4	UTSW	7	27,103,663 (GRCm39)	missense	probably damaging	1.00
R8815:Sptbn4	UTSW	7	27,106,657 (GRCm39)	nonsense	probably null
R8818:Sptbn4	UTSW	7	27,063,592 (GRCm39)	missense	possibly damaging	0.71
R9171:Sptbn4	UTSW	7	27,141,844 (GRCm39)	missense	possibly damaging	0.95
R9259:Sptbn4	UTSW	7	27,067,124 (GRCm39)	missense	possibly damaging	0.74
R9477:Sptbn4	UTSW	7	27,132,624 (GRCm39)	missense	possibly damaging	0.79
R9564:Sptbn4	UTSW	7	27,117,504 (GRCm39)	missense	probably damaging	0.98
R9572:Sptbn4	UTSW	7	27,066,095 (GRCm39)	missense	probably benign	0.16
R9623:Sptbn4	UTSW	7	27,107,807 (GRCm39)	missense	probably damaging	1.00
R9715:Sptbn4	UTSW	7	27,091,000 (GRCm39)	missense	probably damaging	1.00
R9782:Sptbn4	UTSW	7	27,107,993 (GRCm39)	missense	probably benign	0.02
R9790:Sptbn4	UTSW	7	27,071,662 (GRCm39)	missense	probably damaging	0.99
R9791:Sptbn4	UTSW	7	27,071,662 (GRCm39)	missense	probably damaging	0.99
R9798:Sptbn4	UTSW	7	27,056,717 (GRCm39)	makesense	probably null
X0020:Sptbn4	UTSW	7	27,102,159 (GRCm39)	critical splice donor site	probably null
X0066:Sptbn4	UTSW	7	27,056,736 (GRCm39)	unclassified	probably benign
Z1176:Sptbn4	UTSW	7	27,059,450 (GRCm39)	missense	probably damaging	0.99
Z1177:Sptbn4	UTSW	7	27,108,527 (GRCm39)	missense	probably benign	0.41
Z1177:Sptbn4	UTSW	7	27,104,007 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTCGGTACAATGAGAGCTTC -3'
(R):5'- TCCAGTGGTAGACTTATGAAGAGG -3'

Sequencing Primer
(F):5'- GAGAGCTTCTCACCCCCAC -3'
(R):5'- AGACTTATGAAGAGGCAGCGTTTTG -3'

Posted On

2014-11-11