Incidental Mutation 'R2407:Nsf'
ID248065
Institutional Source Beutler Lab
Gene Symbol Nsf
Ensembl Gene ENSMUSG00000034187
Gene NameN-ethylmaleimide sensitive fusion protein
SynonymsSKD2, N-ethylmaleimide sensitive factor
MMRRC Submission 040373-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2407 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location103821782-103954056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103930752 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 26 (E26K)
Ref Sequence ENSEMBL: ENSMUSP00000099364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103075] [ENSMUST00000133774] [ENSMUST00000149642]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103075
AA Change: E26K

PolyPhen 2 Score 0.586 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099364
Gene: ENSMUSG00000034187
AA Change: E26K

DomainStartEndE-ValueType
CDC48_N 5 86 2.7e-16 SMART
CDC48_2 111 183 6.22e-7 SMART
AAA 252 399 3.65e-19 SMART
AAA 535 671 2.2e-13 SMART
low complexity region 674 683 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000107009
Predicted Effect probably benign
Transcript: ENSMUST00000133774
SMART Domains Protein: ENSMUSP00000133591
Gene: ENSMUSG00000034187

DomainStartEndE-ValueType
Pfam:CDC48_N 1 51 1.5e-10 PFAM
CDC48_2 76 148 6.22e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140394
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145126
Predicted Effect possibly damaging
Transcript: ENSMUST00000149642
AA Change: E23K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133603
Gene: ENSMUSG00000034187
AA Change: E23K

DomainStartEndE-ValueType
CDC48_N 2 76 6.51e-10 SMART
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,228 N149I probably benign Het
4931408C20Rik A T 1: 26,682,838 M1087K possibly damaging Het
Agxt G T 1: 93,135,780 A135S probably benign Het
Aldh1a2 A T 9: 71,252,598 I40F probably damaging Het
Ang T A 14: 51,101,646 C81* probably null Het
Apc G T 18: 34,314,262 V1370F possibly damaging Het
Arfgef3 T C 10: 18,677,866 T127A possibly damaging Het
Cd1d1 A G 3: 86,998,182 L168P probably damaging Het
Epb42 C A 2: 121,024,752 V451F probably damaging Het
F5 T A 1: 164,211,872 L2017Q probably damaging Het
Hmcn2 A T 2: 31,335,412 probably null Het
Kif13a G A 13: 46,777,097 P164S probably damaging Het
Kirrel T A 3: 87,084,843 I593F probably benign Het
Lin28b A T 10: 45,381,087 I265N possibly damaging Het
Mctp2 A T 7: 72,200,407 D507E probably benign Het
Morc3 G A 16: 93,844,327 probably null Het
Myo3b T C 2: 70,255,253 Y750H probably damaging Het
Nrp1 T C 8: 128,431,945 S238P probably damaging Het
Otog A G 7: 46,241,540 E41G probably benign Het
Pclo G T 5: 14,678,932 probably benign Het
Pdzd2 T C 15: 12,373,161 D2296G probably damaging Het
Peak1 A G 9: 56,259,226 C473R probably damaging Het
Rad51ap2 T A 12: 11,458,501 M808K probably damaging Het
Sec24b A C 3: 130,002,316 S651A probably benign Het
Slc17a3 G A 13: 23,852,435 probably null Het
Slc4a10 A G 2: 62,313,343 H1074R probably benign Het
Spata31d1b A G 13: 59,716,846 K603E possibly damaging Het
Sptbn4 T A 7: 27,418,098 K409* probably null Het
Tacc2 G A 7: 130,622,040 V152I possibly damaging Het
Tiam2 A G 17: 3,477,261 M65V probably benign Het
Tmem131l G T 3: 83,922,048 Q1100K probably benign Het
Togaram1 T C 12: 64,967,670 M565T probably damaging Het
Trib1 T C 15: 59,654,600 Y340H probably benign Het
Wdr66 A T 5: 123,289,969 M510L probably benign Het
Wdr7 A T 18: 63,760,723 M643L probably benign Het
Zfp51 A T 17: 21,463,831 H236L probably damaging Het
Other mutations in Nsf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Nsf APN 11 103861885 splice site probably benign
IGL01377:Nsf APN 11 103872647 missense probably damaging 0.97
IGL01994:Nsf APN 11 103928782 missense probably damaging 0.98
IGL02141:Nsf APN 11 103828525 missense probably benign 0.02
IGL02663:Nsf APN 11 103930815 missense probably benign 0.04
IGL02871:Nsf APN 11 103862056 splice site probably benign
uhaul UTSW 11 103930752 missense possibly damaging 0.59
R0180:Nsf UTSW 11 103930780 missense probably damaging 1.00
R0880:Nsf UTSW 11 103913372 missense possibly damaging 0.72
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1146:Nsf UTSW 11 103828538 missense probably damaging 1.00
R1203:Nsf UTSW 11 103926126 unclassified probably benign
R1873:Nsf UTSW 11 103859017 missense probably damaging 1.00
R1951:Nsf UTSW 11 103882876 nonsense probably null
R2163:Nsf UTSW 11 103863333 missense possibly damaging 0.64
R2193:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2194:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2287:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2289:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2343:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2345:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2346:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2347:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2350:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2405:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2406:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2408:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2409:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2411:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2435:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2924:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2925:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R2987:Nsf UTSW 11 103859043 splice site probably null
R3177:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3277:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3741:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3742:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R3845:Nsf UTSW 11 103930752 missense possibly damaging 0.59
R4278:Nsf UTSW 11 103930806 missense probably damaging 0.96
R4717:Nsf UTSW 11 103823769 missense probably damaging 1.00
R4775:Nsf UTSW 11 103872593 missense possibly damaging 0.93
R4915:Nsf UTSW 11 103910359 unclassified probably benign
R4918:Nsf UTSW 11 103910359 unclassified probably benign
R5090:Nsf UTSW 11 103910578 missense probably benign 0.00
R5126:Nsf UTSW 11 103882792 nonsense probably null
R5411:Nsf UTSW 11 103882811 missense probably damaging 1.00
R5560:Nsf UTSW 11 103863255 missense possibly damaging 0.47
R6344:Nsf UTSW 11 103861904 missense probably damaging 1.00
R6596:Nsf UTSW 11 103910457 missense probably damaging 0.98
R7155:Nsf UTSW 11 103828530 nonsense probably null
R7272:Nsf UTSW 11 103827238 missense probably damaging 1.00
R7769:Nsf UTSW 11 103928839 missense probably damaging 1.00
X0066:Nsf UTSW 11 103823740 missense probably benign
Z1176:Nsf UTSW 11 103910554 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAAGCAAGGTGACTACCAACC -3'
(R):5'- ATGCAGTTGTGTGGTAAGGAAGG -3'

Sequencing Primer
(F):5'- TGTGATACCTATACCCAGTG -3'
(R):5'- AGGGTGCTTTCTTCTAGTGC -3'
Posted On2014-11-11