Incidental Mutation 'R2407:Rad51ap2'
ID 248066
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission 040373-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2407 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 11508502 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 808 (M808K)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect probably damaging
Transcript: ENSMUST00000124065
AA Change: M808K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: M808K

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,930,212 (GRCm39) N149I probably benign Het
Agxt G T 1: 93,063,502 (GRCm39) A135S probably benign Het
Aldh1a2 A T 9: 71,159,880 (GRCm39) I40F probably damaging Het
Ang T A 14: 51,339,103 (GRCm39) C81* probably null Het
Apc G T 18: 34,447,315 (GRCm39) V1370F possibly damaging Het
Arfgef3 T C 10: 18,553,614 (GRCm39) T127A possibly damaging Het
Cd1d1 A G 3: 86,905,489 (GRCm39) L168P probably damaging Het
Cfap251 A T 5: 123,428,032 (GRCm39) M510L probably benign Het
Epb42 C A 2: 120,855,233 (GRCm39) V451F probably damaging Het
F5 T A 1: 164,039,441 (GRCm39) L2017Q probably damaging Het
Hmcn2 A T 2: 31,225,424 (GRCm39) probably null Het
Kif13a G A 13: 46,930,573 (GRCm39) P164S probably damaging Het
Kirrel1 T A 3: 86,992,150 (GRCm39) I593F probably benign Het
Lin28b A T 10: 45,257,183 (GRCm39) I265N possibly damaging Het
Mctp2 A T 7: 71,850,155 (GRCm39) D507E probably benign Het
Morc3 G A 16: 93,641,215 (GRCm39) probably null Het
Myo3b T C 2: 70,085,597 (GRCm39) Y750H probably damaging Het
Nrp1 T C 8: 129,158,426 (GRCm39) S238P probably damaging Het
Nsf C T 11: 103,821,578 (GRCm39) E26K possibly damaging Het
Otog A G 7: 45,890,964 (GRCm39) E41G probably benign Het
Pclo G T 5: 14,728,946 (GRCm39) probably benign Het
Pdzd2 T C 15: 12,373,247 (GRCm39) D2296G probably damaging Het
Peak1 A G 9: 56,166,510 (GRCm39) C473R probably damaging Het
Sec24b A C 3: 129,795,965 (GRCm39) S651A probably benign Het
Slc17a3 G A 13: 24,036,418 (GRCm39) probably null Het
Slc4a10 A G 2: 62,143,687 (GRCm39) H1074R probably benign Het
Spata31d1b A G 13: 59,864,660 (GRCm39) K603E possibly damaging Het
Spata31e2 A T 1: 26,721,919 (GRCm39) M1087K possibly damaging Het
Sptbn4 T A 7: 27,117,523 (GRCm39) K409* probably null Het
Tacc2 G A 7: 130,223,770 (GRCm39) V152I possibly damaging Het
Tiam2 A G 17: 3,527,536 (GRCm39) M65V probably benign Het
Tmem131l G T 3: 83,829,355 (GRCm39) Q1100K probably benign Het
Togaram1 T C 12: 65,014,444 (GRCm39) M565T probably damaging Het
Trib1 T C 15: 59,526,449 (GRCm39) Y340H probably benign Het
Wdr7 A T 18: 63,893,794 (GRCm39) M643L probably benign Het
Zfp51 A T 17: 21,684,093 (GRCm39) H236L probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9691:Rad51ap2 UTSW 12 11,509,413 (GRCm39) missense possibly damaging 0.70
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTCAGCTTCGCTAGTGAGTAAG -3'
(R):5'- ACCTGCCTTCACATCACAGG -3'

Sequencing Primer
(F):5'- TTTCATCCAAAGAATGAGTCTGC -3'
(R):5'- GGTTTCAACCATTTCCAGT -3'
Posted On 2014-11-11