Incidental Mutation 'R2408:Zmynd19'
ID248082
Institutional Source Beutler Lab
Gene Symbol Zmynd19
Ensembl Gene ENSMUSG00000026974
Gene Namezinc finger, MYND domain containing 19
Synonyms2700064H14Rik
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2408 (G1)
Quality Score210
Status Validated
Chromosome2
Chromosomal Location24949792-24962075 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24958925 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 144 (E144G)
Ref Sequence ENSEMBL: ENSMUSP00000141788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028350] [ENSMUST00000028351] [ENSMUST00000124383] [ENSMUST00000126909] [ENSMUST00000135339] [ENSMUST00000143253] [ENSMUST00000148042] [ENSMUST00000153375]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028350
AA Change: E183G

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028350
Gene: ENSMUSG00000026974
AA Change: E183G

DomainStartEndE-ValueType
Pfam:HNH_3 66 105 1.9e-10 PFAM
Pfam:zf-MYND 167 212 1.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000028351
SMART Domains Protein: ENSMUSP00000028351
Gene: ENSMUSG00000026975

DomainStartEndE-ValueType
Blast:WD40 74 118 3e-10 BLAST
Blast:WD40 128 175 3e-15 BLAST
WD40 183 223 7.43e-1 SMART
WD40 227 267 1.08e-4 SMART
WD40 271 310 1.37e2 SMART
WD40 420 455 1.97e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124383
Predicted Effect probably benign
Transcript: ENSMUST00000126909
Predicted Effect probably benign
Transcript: ENSMUST00000135339
SMART Domains Protein: ENSMUSP00000142067
Gene: ENSMUSG00000026975

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143253
SMART Domains Protein: ENSMUSP00000142315
Gene: ENSMUSG00000026975

DomainStartEndE-ValueType
low complexity region 54 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146382
Predicted Effect possibly damaging
Transcript: ENSMUST00000148042
AA Change: E144G

PolyPhen 2 Score 0.538 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141788
Gene: ENSMUSG00000026974
AA Change: E144G

DomainStartEndE-ValueType
Pfam:HNH_3 27 66 1.4e-10 PFAM
Pfam:zf-MYND 124 173 5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153375
Meta Mutation Damage Score 0.5870 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZMYND19 is a MYND zinc finger domain-containing protein that binds to the C terminus of melanin-concentrating hormone receptor-1 (MCHR1; MIM 601751) (Bachner et al., 2002 [PubMed 12208518]), and to the N termini of alpha-tubulin (TUBA1; MIM 191110), and beta-tubulin (TUBB; MIM 191130) (Francke et al., 2005 [PubMed 16039987]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Other mutations in Zmynd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01905:Zmynd19 APN 2 24951529 missense probably benign 0.04
watson UTSW 2 24958189 nonsense probably null
R0432:Zmynd19 UTSW 2 24958122 missense probably benign 0.01
R1531:Zmynd19 UTSW 2 24958111 missense probably benign 0.02
R2130:Zmynd19 UTSW 2 24952636 nonsense probably null
R3612:Zmynd19 UTSW 2 24951480 missense probably damaging 1.00
R4595:Zmynd19 UTSW 2 24958988 missense probably damaging 1.00
R5165:Zmynd19 UTSW 2 24958189 nonsense probably null
R6133:Zmynd19 UTSW 2 24958119 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TTTCTTAGGGAGAACAAGTGCTGG -3'
(R):5'- CCTCCAGGTTCAACTGACAG -3'

Sequencing Primer
(F):5'- AACAAGTGCTGGGGCTTTAATCC -3'
(R):5'- GAGCTGGAAACTTTGAACCTGC -3'
Posted On2014-11-11