Incidental Mutation 'R2408:Noct'
ID248085
Institutional Source Beutler Lab
Gene Symbol Noct
Ensembl Gene ENSMUSG00000023087
Gene Namenocturnin
SynonymsCcrn4l, Ccr4
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.176) question?
Stock #R2408 (G1)
Quality Score91
Status Not validated
Chromosome3
Chromosomal Location51224447-51251644 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 51225289 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023849] [ENSMUST00000167780]
Predicted Effect probably null
Transcript: ENSMUST00000023849
SMART Domains Protein: ENSMUSP00000023849
Gene: ENSMUSG00000023087

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 3.6e-31 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167780
SMART Domains Protein: ENSMUSP00000130347
Gene: ENSMUSG00000023087

DomainStartEndE-ValueType
low complexity region 48 58 N/A INTRINSIC
Pfam:Exo_endo_phos 144 412 5.7e-29 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to Nocturnin, a gene identified as a circadian clock regulated gene in Xenopus laevis. This protein and Nocturnin protein share similarity with the C-terminal domain of a yeast transcription factor, carbon catabolite repression 4 (CCR4). The mRNA abundance of a similar gene in mouse has been shown to exhibit circadian rhythmicity, which suggests a role for this protein in clock function or as a circadian clock effector. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are resistant to diet-induced obesity and fatty liver development, show increased circulating glucose levels and increased insulin sensitivity on a standard diet and have impaired glucose tolerance on a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Noct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Noct APN 3 51248048 missense probably damaging 0.99
R0256:Noct UTSW 3 51250474 missense probably damaging 1.00
R1399:Noct UTSW 3 51250476 splice site probably null
R1539:Noct UTSW 3 51247912 nonsense probably null
R1618:Noct UTSW 3 51247830 missense probably damaging 1.00
R2001:Noct UTSW 3 51248044 missense probably damaging 1.00
R2176:Noct UTSW 3 51249696 critical splice acceptor site probably null
R4413:Noct UTSW 3 51250335 missense probably damaging 1.00
R4552:Noct UTSW 3 51250168 missense probably benign 0.16
R4690:Noct UTSW 3 51247879 nonsense probably null
R4993:Noct UTSW 3 51250021 missense probably damaging 1.00
R5009:Noct UTSW 3 51248061 missense probably damaging 1.00
R6467:Noct UTSW 3 51250087 missense possibly damaging 0.90
R6631:Noct UTSW 3 51250200 missense probably damaging 1.00
R7454:Noct UTSW 3 51249730 missense probably damaging 1.00
R7467:Noct UTSW 3 51225201 missense probably benign 0.01
R7911:Noct UTSW 3 51247648 intron probably benign
R8201:Noct UTSW 3 51248023 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATCCAGACGGTCCATTCTC -3'
(R):5'- GCAAAACGTTAGCGACTGG -3'

Sequencing Primer
(F):5'- ATGTATCAGAGCCCGCGG -3'
(R):5'- AACGTTAGCGACTGGGGTCAC -3'
Posted On2014-11-11