Incidental Mutation 'R2408:Tmem222'
ID248089
Institutional Source Beutler Lab
Gene Symbol Tmem222
Ensembl Gene ENSMUSG00000028857
Gene Nametransmembrane protein 222
Synonyms5730406H10Rik, D4Ertd196e
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.254) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location133266045-133277792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133271024 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 73 (H73R)
Ref Sequence ENSEMBL: ENSMUSP00000101527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105907] [ENSMUST00000139030]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105907
AA Change: H73R

PolyPhen 2 Score 0.544 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101527
Gene: ENSMUSG00000028857
AA Change: H73R

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:DUF778 61 118 4.4e-28 PFAM
Pfam:DUF778 112 178 3.2e-22 PFAM
transmembrane domain 188 207 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132713
Predicted Effect unknown
Transcript: ENSMUST00000134781
AA Change: H37R
SMART Domains Protein: ENSMUSP00000120532
Gene: ENSMUSG00000028857
AA Change: H37R

DomainStartEndE-ValueType
Pfam:DUF778 26 66 2.7e-16 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137622
AA Change: H52R
SMART Domains Protein: ENSMUSP00000117527
Gene: ENSMUSG00000028857
AA Change: H52R

DomainStartEndE-ValueType
Pfam:DUF778 41 96 2.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139030
SMART Domains Protein: ENSMUSP00000121858
Gene: ENSMUSG00000028857

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153059
Meta Mutation Damage Score 0.9499 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Tmem222
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0496:Tmem222 UTSW 4 133277591 missense possibly damaging 0.66
R4726:Tmem222 UTSW 4 133277664 missense probably benign 0.27
R5330:Tmem222 UTSW 4 133277624 missense possibly damaging 0.83
R6239:Tmem222 UTSW 4 133268295 missense probably damaging 1.00
R6803:Tmem222 UTSW 4 133266843 missense probably benign 0.04
R6884:Tmem222 UTSW 4 133268203 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAGAGGCTGAACCAGTTAC -3'
(R):5'- TCCGTCAGAGAGCTGGTTTC -3'

Sequencing Primer
(F):5'- GGCTGAACCAGTTACTTAAGATGCC -3'
(R):5'- TCTTCCCAGTAGAGATCCGG -3'
Posted On2014-11-11