Incidental Mutation 'R2408:BC051076'
ID248092
Institutional Source Beutler Lab
Gene Symbol BC051076
Ensembl Gene ENSMUSG00000055961
Gene NamecDNA sequence BC051076
Synonyms
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location87963485-87966349 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to T at 87963825 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000069773
SMART Domains Protein: ENSMUSP00000070337
Gene: ENSMUSG00000055961

DomainStartEndE-ValueType
coiled coil region 39 145 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 265 295 N/A INTRINSIC
low complexity region 307 335 N/A INTRINSIC
low complexity region 350 361 N/A INTRINSIC
low complexity region 405 424 N/A INTRINSIC
low complexity region 439 449 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199477
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in BC051076
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:BC051076 APN 5 87964495 unclassified probably benign
IGL01572:BC051076 APN 5 87964690 unclassified probably benign
IGL03263:BC051076 APN 5 87964118 exon noncoding transcript
R0545:BC051076 UTSW 5 87963490 exon noncoding transcript
R2058:BC051076 UTSW 5 87963985 exon noncoding transcript
R3956:BC051076 UTSW 5 87964251 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCGACTCGAAAGGAAACAGC -3'
(R):5'- GATGCATTGAAGATTTCCTCTGC -3'

Sequencing Primer
(F):5'- CTCGAAAGGAAACAGCAGAGAG -3'
(R):5'- GCATTGAAGATTTCCTCTGCTAAGG -3'
Posted On2014-11-11