Incidental Mutation 'R2408:Fam69a'
ID248093
Institutional Source Beutler Lab
Gene Symbol Fam69a
Ensembl Gene ENSMUSG00000029270
Gene Namefamily with sequence similarity 69, member A
Synonyms
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location107908053-107987085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107914425 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 78 (D78G)
Ref Sequence ENSEMBL: ENSMUSP00000114892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031198] [ENSMUST00000145239] [ENSMUST00000153172]
Predicted Effect probably benign
Transcript: ENSMUST00000031198
AA Change: D73G

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000031198
Gene: ENSMUSG00000029270
AA Change: D73G

DomainStartEndE-ValueType
PIP49_N 19 177 1.7e-92 SMART
Pfam:PIP49_C 194 396 1.9e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000145239
AA Change: D28G

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117801
Gene: ENSMUSG00000029270
AA Change: D28G

DomainStartEndE-ValueType
PIP49_N 1 132 1.18e-45 SMART
Pfam:PIP49_C 149 284 2e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153172
AA Change: D78G

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114892
Gene: ENSMUSG00000029270
AA Change: D78G

DomainStartEndE-ValueType
PIP49_N 24 87 1.07e-2 SMART
Meta Mutation Damage Score 0.0884 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the FAM69 family of cysteine-rich type II transmembrane proteins. These proteins localize to the endoplasmic reticulum but their specific functions are unknown. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Fam69a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Fam69a APN 5 107911781 missense probably benign 0.24
R1799:Fam69a UTSW 5 107909847 missense probably damaging 0.98
R2048:Fam69a UTSW 5 107910020 missense probably damaging 0.98
R2169:Fam69a UTSW 5 107909459 nonsense probably null
R3085:Fam69a UTSW 5 107914424 missense probably damaging 1.00
R4446:Fam69a UTSW 5 107924634 missense probably damaging 1.00
R4654:Fam69a UTSW 5 107910116 unclassified probably null
R4979:Fam69a UTSW 5 107909534 nonsense probably null
R5405:Fam69a UTSW 5 107909961 missense probably benign 0.00
R5482:Fam69a UTSW 5 107909663 missense probably damaging 1.00
R6397:Fam69a UTSW 5 107911638 nonsense probably null
R7006:Fam69a UTSW 5 107910161 missense probably benign 0.01
R7465:Fam69a UTSW 5 107909684 missense probably damaging 1.00
R8004:Fam69a UTSW 5 107909666 missense probably damaging 1.00
X0013:Fam69a UTSW 5 107909847 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CACAGCTCTTAGAAGATAGAGACAGA -3'
(R):5'- CCAAAATTCTGTGTATACCCCAG -3'

Sequencing Primer
(F):5'- TTAAGAAAATCTACAGCCACAGAGAG -3'
(R):5'- GTAAATGCAAAGCCTGAGTTCCTCTC -3'
Posted On2014-11-11