Incidental Mutation 'R2408:Hnf1a'
ID248094
Institutional Source Beutler Lab
Gene Symbol Hnf1a
Ensembl Gene ENSMUSG00000029556
Gene NameHNF1 homeobox A
SynonymsHnf1alpha, HNF1-alpha, Tcf1, LFB1, hepatocyte nuclear factor 1, HNF1[a], HNF1, Hnf-1
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R2408 (G1)
Quality Score173
Status Validated
Chromosome5
Chromosomal Location114948980-114971094 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 114960011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031535] [ENSMUST00000176550] [ENSMUST00000176911]
PDB Structure CRYSTAL STRUCTURE OF A COMPLEX BETWEEN THE DIMERIZATION DOMAIN OF HNF-1 ALPHA AND THE COACTIVATOR DCOH [X-RAY DIFFRACTION]
HNF-1ALPHA DIMERIZATION DOMAIN, WITH SELENOMETHIONINE SUBSTITUED AT LEU 12 [X-RAY DIFFRACTION]
DIMERIZATION DOMAIN OF HNF-1ALPHA WITH A LEU 13 SELENOMETHIONINE SUBSTITUTION [X-RAY DIFFRACTION]
WILD-TYPE HNF-1ALPHA DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
Crystal Structure of Dimerization Domain (1-33) of HNF-1alpha [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000031535
SMART Domains Protein: ENSMUSP00000031535
Gene: ENSMUSG00000029556

DomainStartEndE-ValueType
Pfam:HNF-1_N 8 168 4e-57 PFAM
HOX 199 282 1.85e-7 SMART
low complexity region 288 297 N/A INTRINSIC
Blast:HOX 394 439 7e-20 BLAST
Pfam:HNF-1A_C 540 627 3.4e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176550
SMART Domains Protein: ENSMUSP00000135678
Gene: ENSMUSG00000029556

DomainStartEndE-ValueType
Pfam:HNF-1_N 1 176 4e-86 PFAM
Blast:HOX 199 238 2e-20 BLAST
SCOP:d1lfb__ 203 238 2e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176911
SMART Domains Protein: ENSMUSP00000135539
Gene: ENSMUSG00000029556

DomainStartEndE-ValueType
Pfam:HNF-1_N 1 118 6.4e-32 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: This gene encodes a hepatic transcription factor. The encoded protein is not a member of the T-cell factor family, and is distinct from T-cell specific transcription factor 7 which has also been referred to by the symbol Tcf1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygous null mutants die at 3-6 weeks from progressive wasting syndrome, liver and renal dysfunction and type II diabetes. Mutants have little or no phenylalanine hydroxylase, albumin, alpha 1-antitrypsin and secreted insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Hnf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Hnf1a APN 5 114953673 missense probably damaging 1.00
IGL02192:Hnf1a APN 5 114960118 missense probably damaging 1.00
IGL03053:Hnf1a APN 5 114970733 missense probably benign 0.00
R0522:Hnf1a UTSW 5 114950688 splice site probably benign
R0543:Hnf1a UTSW 5 114950744 missense probably benign
R1498:Hnf1a UTSW 5 114970537 missense probably damaging 1.00
R1827:Hnf1a UTSW 5 114960195 missense probably damaging 1.00
R1852:Hnf1a UTSW 5 114970711 missense probably damaging 1.00
R2898:Hnf1a UTSW 5 114960047 nonsense probably null
R4050:Hnf1a UTSW 5 114970574 missense probably damaging 1.00
R4627:Hnf1a UTSW 5 114955871 missense probably damaging 1.00
R4859:Hnf1a UTSW 5 114955252 missense possibly damaging 0.84
R4873:Hnf1a UTSW 5 114970673 missense probably benign 0.00
R4875:Hnf1a UTSW 5 114970673 missense probably benign 0.00
R6488:Hnf1a UTSW 5 114955961 missense probably benign
R7134:Hnf1a UTSW 5 114953387 missense probably damaging 1.00
R7999:Hnf1a UTSW 5 114960174 nonsense probably null
R8085:Hnf1a UTSW 5 114970673 missense probably benign 0.00
R8093:Hnf1a UTSW 5 114955277 missense probably benign
R8360:Hnf1a UTSW 5 114953332 missense possibly damaging 0.93
R8539:Hnf1a UTSW 5 114970517 critical splice donor site probably null
X0067:Hnf1a UTSW 5 114955480 missense possibly damaging 0.52
Z1176:Hnf1a UTSW 5 114950124 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATTCAGCAGAGAGTGAGTTCC -3'
(R):5'- AAGTCGTACTTGCAGCAGC -3'

Sequencing Primer
(F):5'- AGGACCCCAGTGTGTGTAC -3'
(R):5'- GCAGCAGCACAACATCCC -3'
Posted On2014-11-11