Mutagenetix > Incidental Mutation

Incidental Mutation 'R2408:Gm5117'

248098

Institutional Source

Beutler Lab

Gene Symbol

Gm5117

Ensembl Gene

ENSMUSG00000093862

Gene Name

predicted gene 5117

Synonyms

MMRRC Submission

040374-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.896) question?

Stock #

R2408 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32227236-32229788 bp(-) (GRCm39)

Type of Mutation

exon

DNA Base Change (assembly)

T to C at 32227306 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178878

SMART Domains

Protein: ENSMUSP00000137046
Gene: ENSMUSG00000093862

Domain	Start	End	E-Value	Type
low complexity region	147	158	N/A	INTRINSIC
low complexity region	608	627	N/A	INTRINSIC
Pfam:Met_10	666	799	1.5e-9	PFAM
Pfam:UPF0020	672	770	4e-8	PFAM
Pfam:Methyltransf_18	687	815	5e-10	PFAM
Pfam:Methyltransf_31	688	801	1.5e-10	PFAM
Pfam:Methyltransf_26	688	803	1e-8	PFAM
Pfam:Methyltransf_15	688	842	5e-48	PFAM

Meta Mutation Damage Score

0.4383

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.8%

Validation Efficiency

97% (33/34)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg1	T	G	8: 95,730,121 (GRCm39)	L103V	probably null	Het
BC051076	C	T	5: 88,111,684 (GRCm39)		noncoding transcript	Het
Ccdc191	A	T	16: 43,751,561 (GRCm39)	Q239L	probably benign	Het
Dennd4b	G	T	3: 90,178,882 (GRCm39)	G538*	probably null	Het
Dipk1a	T	C	5: 108,062,291 (GRCm39)	D78G	possibly damaging	Het
Dusp7	C	T	9: 106,246,361 (GRCm39)	A122V	probably benign	Het
Exd2	T	G	12: 80,531,015 (GRCm39)		probably benign	Het
Gm10782	C	A	13: 56,510,944 (GRCm39)		noncoding transcript	Het
Hhipl1	T	A	12: 108,284,806 (GRCm39)	D386E	probably benign	Het
Hnf1a	C	T	5: 115,098,070 (GRCm39)		probably null	Het
Ifi204	A	G	1: 173,583,198 (GRCm39)	F340S	possibly damaging	Het
Kalrn	C	T	16: 33,810,180 (GRCm39)	D2525N	possibly damaging	Het
Med26	T	C	8: 73,249,476 (GRCm39)	D541G	probably benign	Het
Mgam	T	A	6: 40,663,456 (GRCm39)	L1218Q	probably damaging	Het
Msh5	T	C	17: 35,264,095 (GRCm39)	D136G	probably damaging	Het
Nbl1	C	T	4: 138,810,843 (GRCm39)	C117Y	probably damaging	Het
Niban2	A	G	2: 32,813,482 (GRCm39)	Y565C	probably damaging	Het
Noct	T	C	3: 51,132,710 (GRCm39)		probably null	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Prmt2	A	T	10: 76,044,301 (GRCm39)	M417K	probably damaging	Het
Rptor	A	G	11: 119,748,277 (GRCm39)	E3G	probably damaging	Het
Sgms1	G	A	19: 32,137,072 (GRCm39)	R165*	probably null	Het
Slc13a5	A	G	11: 72,152,902 (GRCm39)	S60P	probably damaging	Het
Sycp1	T	C	3: 102,832,575 (GRCm39)	Y197C	probably damaging	Het
Tmem222	T	C	4: 132,998,335 (GRCm39)	H73R	possibly damaging	Het
Trmt1l	G	A	1: 151,315,267 (GRCm39)	G151D	possibly damaging	Het
Ttc16	A	G	2: 32,658,020 (GRCm39)	F409L	probably benign	Het
Ubap2l	T	C	3: 89,916,439 (GRCm39)	Q925R	probably null	Het
Ucn3	T	G	13: 3,991,413 (GRCm39)	I80L	probably benign	Het
Vwa3a	T	C	7: 120,372,517 (GRCm39)	S302P	probably benign	Het
Zfp804b	A	T	5: 7,229,410 (GRCm39)		probably benign	Het
Zmynd19	A	G	2: 24,848,937 (GRCm39)	E144G	possibly damaging	Het

Other mutations in Gm5117

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01022:Gm5117	APN	8	32,228,515 (GRCm39)	exon	noncoding transcript
IGL01362:Gm5117	APN	8	32,227,947 (GRCm39)	exon	noncoding transcript
IGL01972:Gm5117	APN	8	32,227,787 (GRCm39)	exon	noncoding transcript
IGL02100:Gm5117	APN	8	32,227,412 (GRCm39)	exon	noncoding transcript
IGL02339:Gm5117	APN	8	32,228,254 (GRCm39)	exon	noncoding transcript
IGL02366:Gm5117	APN	8	32,227,887 (GRCm39)	exon	noncoding transcript
IGL02505:Gm5117	APN	8	32,228,344 (GRCm39)	exon	noncoding transcript
IGL02698:Gm5117	APN	8	32,229,767 (GRCm39)	exon	noncoding transcript
IGL03310:Gm5117	APN	8	32,228,836 (GRCm39)	exon	noncoding transcript
IGL02835:Gm5117	UTSW	8	32,227,198 (GRCm39)	unclassified	noncoding transcript
R1816:Gm5117	UTSW	8	32,228,986 (GRCm39)	exon	noncoding transcript
R2157:Gm5117	UTSW	8	32,228,222 (GRCm39)	exon	noncoding transcript
R2353:Gm5117	UTSW	8	32,229,223 (GRCm39)	exon	noncoding transcript
R2404:Gm5117	UTSW	8	32,227,306 (GRCm39)	exon	noncoding transcript
R2409:Gm5117	UTSW	8	32,227,306 (GRCm39)	exon	noncoding transcript
R2510:Gm5117	UTSW	8	32,228,383 (GRCm39)	exon	noncoding transcript
R4686:Gm5117	UTSW	8	32,229,284 (GRCm39)	exon	noncoding transcript
R4953:Gm5117	UTSW	8	32,228,608 (GRCm39)	exon	noncoding transcript
R5244:Gm5117	UTSW	8	32,228,305 (GRCm39)	exon	noncoding transcript
R5275:Gm5117	UTSW	8	32,229,595 (GRCm39)	exon	noncoding transcript
R5329:Gm5117	UTSW	8	32,227,910 (GRCm39)	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TTCATTAGCGTCCTTTAAAACTCGG -3'
(R):5'- ACTGCAGAGACCTTCGACATTAG -3'

Sequencing Primer
(F):5'- GGGAGTTTTCCACATCACATG -3'
(R):5'- GACCTTCGACATTAGGACAATGATG -3'

Posted On

2014-11-11