Incidental Mutation 'R2408:Med26'
ID248099
Institutional Source Beutler Lab
Gene Symbol Med26
Ensembl Gene ENSMUSG00000045248
Gene Namemediator complex subunit 26
Synonyms5730493L18Rik, Crsp7
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72494561-72548270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72495632 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 541 (D541G)
Ref Sequence ENSEMBL: ENSMUSP00000058697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058534] [ENSMUST00000152080]
Predicted Effect probably benign
Transcript: ENSMUST00000058534
AA Change: D541G

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000058697
Gene: ENSMUSG00000045248
AA Change: D541G

DomainStartEndE-ValueType
TFS2N 12 86 6.67e-21 SMART
low complexity region 93 108 N/A INTRINSIC
Pfam:Med26_M 177 405 3e-80 PFAM
Pfam:Med26_C 407 586 5.1e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141352
SMART Domains Protein: ENSMUSP00000122215
Gene: ENSMUSG00000019731

DomainStartEndE-ValueType
Pfam:EamA 5 58 1.5e-6 PFAM
Pfam:UAA 6 214 4e-8 PFAM
Pfam:TPT 67 211 1.7e-38 PFAM
Pfam:EamA 76 211 1.4e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152080
SMART Domains Protein: ENSMUSP00000115754
Gene: ENSMUSG00000019731

DomainStartEndE-ValueType
Pfam:TPT 28 333 8.3e-95 PFAM
Pfam:EamA 188 334 7.1e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212699
Meta Mutation Damage Score 0.0781 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Med26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Med26 APN 8 72495874 missense possibly damaging 0.94
IGL02897:Med26 APN 8 72496521 missense probably benign 0.00
R2017:Med26 UTSW 8 72496947 missense probably damaging 1.00
R2203:Med26 UTSW 8 72495902 missense probably damaging 0.96
R2913:Med26 UTSW 8 72496112 missense possibly damaging 0.93
R4030:Med26 UTSW 8 72496569 missense probably damaging 0.99
R4904:Med26 UTSW 8 72496847 missense probably damaging 1.00
R5042:Med26 UTSW 8 72497075 missense probably damaging 1.00
R6682:Med26 UTSW 8 72496083 missense probably benign 0.12
R6755:Med26 UTSW 8 72495833 missense probably damaging 1.00
R6978:Med26 UTSW 8 72496583 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATGCACATGATGGCCAGGTC -3'
(R):5'- AACTGGAAGGAGCTATCACG -3'

Sequencing Primer
(F):5'- AGGTCAGGTGCTCAGTCCAAG -3'
(R):5'- TGAGATCATACAGTCCTACCTGAG -3'
Posted On2014-11-11