Incidental Mutation 'R2408:Adgrg1'
ID248100
Institutional Source Beutler Lab
Gene Symbol Adgrg1
Ensembl Gene ENSMUSG00000031785
Gene Nameadhesion G protein-coupled receptor G1
SynonymsCyt28, Gpr56
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R2408 (G1)
Quality Score183
Status Validated
Chromosome8
Chromosomal Location94974751-95014217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 95003493 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 103 (L103V)
Ref Sequence ENSEMBL: ENSMUSP00000148374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093271] [ENSMUST00000179619] [ENSMUST00000211944] [ENSMUST00000211984] [ENSMUST00000212118] [ENSMUST00000212141] [ENSMUST00000212531] [ENSMUST00000212581] [ENSMUST00000212660] [ENSMUST00000212799] [ENSMUST00000212956] [ENSMUST00000212976] [ENSMUST00000212995]
Predicted Effect probably damaging
Transcript: ENSMUST00000093271
AA Change: L103V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090959
Gene: ENSMUSG00000031785
AA Change: L103V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 8.1e-32 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179619
AA Change: L103V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000137520
Gene: ENSMUSG00000031785
AA Change: L103V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 3.4e-31 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211911
Predicted Effect probably null
Transcript: ENSMUST00000211944
Predicted Effect probably damaging
Transcript: ENSMUST00000211984
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212118
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212141
AA Change: L103V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably null
Transcript: ENSMUST00000212531
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000212581
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212660
AA Change: L103V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000212799
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000212956
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212976
AA Change: L108V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000212995
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor family and regulates brain cortical patterning. The encoded protein binds specifically to transglutaminase 2, a component of tissue and tumor stroma implicated as an inhibitor of tumor progression. Mutations in this gene are associated with a brain malformation known as bilateral frontoparietal polymicrogyria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit neuronal ectopias in the frontoparietal cortex due to disruptions in the pial basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Adgrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Adgrg1 APN 8 95005243 missense probably damaging 1.00
IGL01138:Adgrg1 APN 8 95003457 missense probably damaging 1.00
IGL01806:Adgrg1 APN 8 95012931 missense probably damaging 1.00
IGL02229:Adgrg1 APN 8 95003511 missense probably damaging 1.00
IGL03109:Adgrg1 APN 8 95007676 unclassified probably benign
D4043:Adgrg1 UTSW 8 95005229 unclassified probably null
R0383:Adgrg1 UTSW 8 95011742 missense probably damaging 1.00
R1155:Adgrg1 UTSW 8 95006840 missense possibly damaging 0.92
R1656:Adgrg1 UTSW 8 95011810 nonsense probably null
R1944:Adgrg1 UTSW 8 95007300 missense probably damaging 0.99
R1952:Adgrg1 UTSW 8 95008491 critical splice donor site probably null
R3776:Adgrg1 UTSW 8 95009655 missense probably damaging 0.99
R3813:Adgrg1 UTSW 8 95011565 missense probably benign 0.34
R4254:Adgrg1 UTSW 8 95005902 unclassified probably null
R4255:Adgrg1 UTSW 8 95005902 unclassified probably null
R4951:Adgrg1 UTSW 8 95005246 missense probably damaging 1.00
R4997:Adgrg1 UTSW 8 95009520 missense probably damaging 1.00
R5152:Adgrg1 UTSW 8 95009745 missense probably damaging 1.00
R6122:Adgrg1 UTSW 8 95002501 missense probably benign 0.45
R6897:Adgrg1 UTSW 8 95002498 missense probably benign
R7446:Adgrg1 UTSW 8 95011784 missense probably damaging 1.00
R7736:Adgrg1 UTSW 8 95005337 missense probably benign
R7784:Adgrg1 UTSW 8 95012882 nonsense probably null
Z1177:Adgrg1 UTSW 8 95007630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACTTCCGCTTCTGTGGC -3'
(R):5'- CAGCCTTACTGTGGAAGGAG -3'

Sequencing Primer
(F):5'- TTCTGTGGCCAGCGGAAC -3'
(R):5'- GAAGATGAAGCTCGGAGCCCC -3'
Posted On2014-11-11