Mutagenetix > Incidental Mutation

Incidental Mutation 'R2408:Adgrg1'

248100

Institutional Source

Beutler Lab

Gene Symbol

Adgrg1

Ensembl Gene

ENSMUSG00000031785

Gene Name

adhesion G protein-coupled receptor G1

Synonyms

Cyt28, Gpr56

MMRRC Submission

040374-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R2408 (G1)

Quality Score

183

Status

Validated

Chromosome

Chromosomal Location

95701379-95740845 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 95730121 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 103 (L103V)

Ref Sequence

ENSEMBL: ENSMUSP00000148374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093271] [ENSMUST00000179619] [ENSMUST00000211944] [ENSMUST00000211984] [ENSMUST00000212118] [ENSMUST00000212956] [ENSMUST00000212581] [ENSMUST00000212799] [ENSMUST00000212976] [ENSMUST00000212531] [ENSMUST00000212141] [ENSMUST00000212660] [ENSMUST00000212995]

AlphaFold

Q8K209

Predicted Effect

probably damaging
Transcript: ENSMUST00000093271
AA Change: L103V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000090959
Gene: ENSMUSG00000031785
AA Change: L103V

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
GPS	342	394	1.42e-12	SMART
Pfam:7tm_2	400	648	8.1e-32	PFAM
low complexity region	678	685	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000179619
AA Change: L103V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000137520
Gene: ENSMUSG00000031785
AA Change: L103V

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
GPS	342	394	1.42e-12	SMART
Pfam:7tm_2	400	648	3.4e-31	PFAM
low complexity region	678	685	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211806

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211911

Predicted Effect

probably null
Transcript: ENSMUST00000211944

Predicted Effect

probably damaging
Transcript: ENSMUST00000211984
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212118
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably null
Transcript: ENSMUST00000212956
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably null
Transcript: ENSMUST00000212581
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212799
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212976
AA Change: L108V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably null
Transcript: ENSMUST00000212531
AA Change: L103V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212141
AA Change: L103V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000212660
AA Change: L103V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably null
Transcript: ENSMUST00000212995

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 93.8%

Validation Efficiency

97% (33/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor family and regulates brain cortical patterning. The encoded protein binds specifically to transglutaminase 2, a component of tissue and tumor stroma implicated as an inhibitor of tumor progression. Mutations in this gene are associated with a brain malformation known as bilateral frontoparietal polymicrogyria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit neuronal ectopias in the frontoparietal cortex due to disruptions in the pial basement membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
BC051076	C	T	5: 88,111,684 (GRCm39)		noncoding transcript	Het
Ccdc191	A	T	16: 43,751,561 (GRCm39)	Q239L	probably benign	Het
Dennd4b	G	T	3: 90,178,882 (GRCm39)	G538*	probably null	Het
Dipk1a	T	C	5: 108,062,291 (GRCm39)	D78G	possibly damaging	Het
Dusp7	C	T	9: 106,246,361 (GRCm39)	A122V	probably benign	Het
Exd2	T	G	12: 80,531,015 (GRCm39)		probably benign	Het
Gm10782	C	A	13: 56,510,944 (GRCm39)		noncoding transcript	Het
Gm5117	T	C	8: 32,227,306 (GRCm39)		noncoding transcript	Het
Hhipl1	T	A	12: 108,284,806 (GRCm39)	D386E	probably benign	Het
Hnf1a	C	T	5: 115,098,070 (GRCm39)		probably null	Het
Ifi204	A	G	1: 173,583,198 (GRCm39)	F340S	possibly damaging	Het
Kalrn	C	T	16: 33,810,180 (GRCm39)	D2525N	possibly damaging	Het
Med26	T	C	8: 73,249,476 (GRCm39)	D541G	probably benign	Het
Mgam	T	A	6: 40,663,456 (GRCm39)	L1218Q	probably damaging	Het
Msh5	T	C	17: 35,264,095 (GRCm39)	D136G	probably damaging	Het
Nbl1	C	T	4: 138,810,843 (GRCm39)	C117Y	probably damaging	Het
Niban2	A	G	2: 32,813,482 (GRCm39)	Y565C	probably damaging	Het
Noct	T	C	3: 51,132,710 (GRCm39)		probably null	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Prmt2	A	T	10: 76,044,301 (GRCm39)	M417K	probably damaging	Het
Rptor	A	G	11: 119,748,277 (GRCm39)	E3G	probably damaging	Het
Sgms1	G	A	19: 32,137,072 (GRCm39)	R165*	probably null	Het
Slc13a5	A	G	11: 72,152,902 (GRCm39)	S60P	probably damaging	Het
Sycp1	T	C	3: 102,832,575 (GRCm39)	Y197C	probably damaging	Het
Tmem222	T	C	4: 132,998,335 (GRCm39)	H73R	possibly damaging	Het
Trmt1l	G	A	1: 151,315,267 (GRCm39)	G151D	possibly damaging	Het
Ttc16	A	G	2: 32,658,020 (GRCm39)	F409L	probably benign	Het
Ubap2l	T	C	3: 89,916,439 (GRCm39)	Q925R	probably null	Het
Ucn3	T	G	13: 3,991,413 (GRCm39)	I80L	probably benign	Het
Vwa3a	T	C	7: 120,372,517 (GRCm39)	S302P	probably benign	Het
Zfp804b	A	T	5: 7,229,410 (GRCm39)		probably benign	Het
Zmynd19	A	G	2: 24,848,937 (GRCm39)	E144G	possibly damaging	Het

Other mutations in Adgrg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00983:Adgrg1	APN	8	95,731,871 (GRCm39)	missense	probably damaging	1.00
IGL01138:Adgrg1	APN	8	95,730,085 (GRCm39)	missense	probably damaging	1.00
IGL01806:Adgrg1	APN	8	95,739,559 (GRCm39)	missense	probably damaging	1.00
IGL02229:Adgrg1	APN	8	95,730,139 (GRCm39)	missense	probably damaging	1.00
IGL03109:Adgrg1	APN	8	95,734,304 (GRCm39)	unclassified	probably benign
D4043:Adgrg1	UTSW	8	95,731,857 (GRCm39)	splice site	probably null
R0383:Adgrg1	UTSW	8	95,738,370 (GRCm39)	missense	probably damaging	1.00
R1155:Adgrg1	UTSW	8	95,733,468 (GRCm39)	missense	possibly damaging	0.92
R1656:Adgrg1	UTSW	8	95,738,438 (GRCm39)	nonsense	probably null
R1944:Adgrg1	UTSW	8	95,733,928 (GRCm39)	missense	probably damaging	0.99
R1952:Adgrg1	UTSW	8	95,735,119 (GRCm39)	critical splice donor site	probably null
R3776:Adgrg1	UTSW	8	95,736,283 (GRCm39)	missense	probably damaging	0.99
R3813:Adgrg1	UTSW	8	95,738,193 (GRCm39)	missense	probably benign	0.34
R4254:Adgrg1	UTSW	8	95,732,530 (GRCm39)	splice site	probably null
R4255:Adgrg1	UTSW	8	95,732,530 (GRCm39)	splice site	probably null
R4951:Adgrg1	UTSW	8	95,731,874 (GRCm39)	missense	probably damaging	1.00
R4997:Adgrg1	UTSW	8	95,736,148 (GRCm39)	missense	probably damaging	1.00
R5152:Adgrg1	UTSW	8	95,736,373 (GRCm39)	missense	probably damaging	1.00
R6122:Adgrg1	UTSW	8	95,729,129 (GRCm39)	missense	probably benign	0.45
R6897:Adgrg1	UTSW	8	95,729,126 (GRCm39)	missense	probably benign
R7446:Adgrg1	UTSW	8	95,738,412 (GRCm39)	missense	probably damaging	1.00
R7736:Adgrg1	UTSW	8	95,731,965 (GRCm39)	missense	probably benign
R7784:Adgrg1	UTSW	8	95,739,510 (GRCm39)	nonsense	probably null
R8187:Adgrg1	UTSW	8	95,732,446 (GRCm39)	missense	probably benign	0.01
R8425:Adgrg1	UTSW	8	95,735,035 (GRCm39)	missense	probably damaging	1.00
R8474:Adgrg1	UTSW	8	95,729,936 (GRCm39)	missense	probably damaging	1.00
R8674:Adgrg1	UTSW	8	95,727,526 (GRCm39)	intron	probably benign
R8683:Adgrg1	UTSW	8	95,736,276 (GRCm39)	missense	probably damaging	1.00
Z1177:Adgrg1	UTSW	8	95,734,258 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGACTTCCGCTTCTGTGGC -3'
(R):5'- CAGCCTTACTGTGGAAGGAG -3'

Sequencing Primer
(F):5'- TTCTGTGGCCAGCGGAAC -3'
(R):5'- GAAGATGAAGCTCGGAGCCCC -3'

Posted On

2014-11-11