Incidental Mutation 'R2408:Prmt2'
ID248102
Institutional Source Beutler Lab
Gene Symbol Prmt2
Ensembl Gene ENSMUSG00000020230
Gene Nameprotein arginine N-methyltransferase 2
SynonymsHrmt1l1
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location76207222-76237865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 76208467 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 417 (M417K)
Ref Sequence ENSEMBL: ENSMUSP00000097166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020452] [ENSMUST00000099571] [ENSMUST00000099572] [ENSMUST00000128099] [ENSMUST00000137857]
Predicted Effect probably damaging
Transcript: ENSMUST00000020452
AA Change: M417K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020452
Gene: ENSMUSG00000020230
AA Change: M417K

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099571
AA Change: M417K

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097166
Gene: ENSMUSG00000020230
AA Change: M417K

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 122 253 2.5e-8 PFAM
Pfam:PRMT5 123 427 2.4e-13 PFAM
Pfam:Met_10 127 244 5.1e-8 PFAM
Pfam:MTS 134 223 5.7e-11 PFAM
Pfam:Methyltransf_31 147 294 1.5e-8 PFAM
Pfam:Methyltransf_26 150 224 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099572
AA Change: M447K

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097167
Gene: ENSMUSG00000020230
AA Change: M447K

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 124 253 3.1e-8 PFAM
Pfam:PRMT5 124 451 1.2e-11 PFAM
Pfam:MTS 137 223 3.3e-10 PFAM
Pfam:Methyltransf_31 147 294 1.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102114
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128048
Predicted Effect probably benign
Transcript: ENSMUST00000128099
SMART Domains Protein: ENSMUSP00000137707
Gene: ENSMUSG00000020230

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.3e-9 PFAM
Pfam:Met_10 122 235 3.8e-8 PFAM
Pfam:TehB 122 235 6.9e-8 PFAM
Pfam:MTS 133 223 2e-11 PFAM
Pfam:Methyltransf_31 147 243 9.3e-9 PFAM
Pfam:Methyltransf_26 150 224 4.6e-10 PFAM
Pfam:Methyltransf_11 154 238 3.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137857
SMART Domains Protein: ENSMUSP00000137725
Gene: ENSMUSG00000020230

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
SH3 45 100 4.22e-15 SMART
Pfam:PrmA 120 253 1.5e-9 PFAM
Pfam:Met_10 129 235 4.2e-7 PFAM
Pfam:MTS 137 223 1.1e-10 PFAM
Pfam:Methyltransf_31 147 243 9.2e-9 PFAM
Pfam:Methyltransf_11 154 237 1.7e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220116
Meta Mutation Damage Score 0.6945 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display a hyperplastic response to vascular injury while mutant mouse embryonic fibroblasts show an earlier S phase entry following release of serum starvation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Prmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Prmt2 APN 10 76222493 missense probably damaging 1.00
IGL01663:Prmt2 APN 10 76217309 splice site probably null
IGL02015:Prmt2 APN 10 76226255 nonsense probably null
IGL03094:Prmt2 APN 10 76210390 splice site probably benign
R0352:Prmt2 UTSW 10 76208503 missense possibly damaging 0.89
R0617:Prmt2 UTSW 10 76208683 intron probably benign
R0831:Prmt2 UTSW 10 76207807 unclassified probably benign
R0885:Prmt2 UTSW 10 76222565 missense probably damaging 1.00
R1882:Prmt2 UTSW 10 76222468 missense probably benign 0.00
R2022:Prmt2 UTSW 10 76225458 nonsense probably null
R2312:Prmt2 UTSW 10 76226255 nonsense probably null
R2401:Prmt2 UTSW 10 76225415 nonsense probably null
R3753:Prmt2 UTSW 10 76225303 missense probably benign 0.01
R4707:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4785:Prmt2 UTSW 10 76226221 missense probably damaging 0.96
R4937:Prmt2 UTSW 10 76221008 missense probably damaging 1.00
R5072:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5073:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5074:Prmt2 UTSW 10 76222556 missense probably damaging 1.00
R5851:Prmt2 UTSW 10 76236740 missense possibly damaging 0.61
R6084:Prmt2 UTSW 10 76210444 missense probably benign 0.23
R6120:Prmt2 UTSW 10 76209446 missense possibly damaging 0.51
R6239:Prmt2 UTSW 10 76222591 nonsense probably null
R6317:Prmt2 UTSW 10 76222517 missense probably benign 0.15
R6659:Prmt2 UTSW 10 76217374 missense possibly damaging 0.85
R7174:Prmt2 UTSW 10 76225339 missense probably benign 0.00
R7421:Prmt2 UTSW 10 76221078 missense probably benign 0.00
R7485:Prmt2 UTSW 10 76221004 nonsense probably null
R8326:Prmt2 UTSW 10 76217413 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATGTAGCAGCGGACATGC -3'
(R):5'- ATGAGACTTAAGCTCCGTGTCCC -3'

Sequencing Primer
(F):5'- GGACATGCATCTGAAACCGTTC -3'
(R):5'- TCAGTGCAGAGGACCTCGTTG -3'
Posted On2014-11-11