Incidental Mutation 'R2408:Exd2'
ID248106
Institutional Source Beutler Lab
Gene Symbol Exd2
Ensembl Gene ENSMUSG00000032705
Gene Nameexonuclease 3'-5' domain containing 2
Synonyms4930539P14Rik, Exdl2
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80463095-80500227 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 80484241 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151717 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038185] [ENSMUST00000219039] [ENSMUST00000219272]
Predicted Effect probably benign
Transcript: ENSMUST00000038185
SMART Domains Protein: ENSMUSP00000043049
Gene: ENSMUSG00000032705

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 40 72 N/A INTRINSIC
35EXOc 105 291 3.8e-10 SMART
Blast:HNHc 438 492 1e-6 BLAST
low complexity region 517 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219039
Predicted Effect probably benign
Transcript: ENSMUST00000219272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219477
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Ucn3 T G 13: 3,941,413 I80L probably benign Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Exd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Exd2 APN 12 80476166 missense probably damaging 1.00
IGL00546:Exd2 APN 12 80480547 missense probably benign 0.05
IGL02964:Exd2 APN 12 80480528 missense probably damaging 0.99
IGL03036:Exd2 APN 12 80489411 missense probably damaging 1.00
R0304:Exd2 UTSW 12 80491240 unclassified probably benign
R0436:Exd2 UTSW 12 80490770 splice site probably benign
R1290:Exd2 UTSW 12 80484326 missense probably benign 0.00
R1772:Exd2 UTSW 12 80489479 missense probably benign 0.00
R2102:Exd2 UTSW 12 80480603 missense possibly damaging 0.78
R2104:Exd2 UTSW 12 80496801 missense probably benign 0.01
R3693:Exd2 UTSW 12 80480693 missense probably damaging 1.00
R4748:Exd2 UTSW 12 80480576 missense probably damaging 1.00
R4773:Exd2 UTSW 12 80475818 missense possibly damaging 0.46
R5022:Exd2 UTSW 12 80496790 missense probably damaging 1.00
R5057:Exd2 UTSW 12 80496790 missense probably damaging 1.00
R5179:Exd2 UTSW 12 80484344 missense probably damaging 1.00
R5377:Exd2 UTSW 12 80489448 missense probably damaging 1.00
R7246:Exd2 UTSW 12 80480535 missense probably damaging 1.00
R7761:Exd2 UTSW 12 80475772 missense probably damaging 0.98
R7776:Exd2 UTSW 12 80492560 missense probably damaging 1.00
R8032:Exd2 UTSW 12 80489653 missense probably benign 0.00
R8420:Exd2 UTSW 12 80475997 missense probably benign
R8559:Exd2 UTSW 12 80475857 missense probably benign 0.00
RF013:Exd2 UTSW 12 80475932 frame shift probably null
RF015:Exd2 UTSW 12 80475917 intron probably benign
RF022:Exd2 UTSW 12 80475917 intron probably benign
RF023:Exd2 UTSW 12 80475915 intron probably benign
RF025:Exd2 UTSW 12 80475955 intron probably benign
RF029:Exd2 UTSW 12 80475946 frame shift probably null
RF035:Exd2 UTSW 12 80475900 intron probably benign
RF035:Exd2 UTSW 12 80475955 intron probably benign
RF039:Exd2 UTSW 12 80475941 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGTAGTGTTGCAGTGAATAGC -3'
(R):5'- TGCATTGAAGACTAGAACCAACTC -3'

Sequencing Primer
(F):5'- GTCCTTTGGATAAACTCCCAGAAAAG -3'
(R):5'- CCTCTGATCACAAGTACCTGG -3'
Posted On2014-11-11