Incidental Mutation 'R2408:Ucn3'
ID248108
Institutional Source Beutler Lab
Gene Symbol Ucn3
Ensembl Gene ENSMUSG00000044988
Gene Nameurocortin 3
SynonymsUrocortin III
MMRRC Submission 040374-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2408 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location3940688-3945349 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 3941413 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 80 (I80L)
Ref Sequence ENSEMBL: ENSMUSP00000049678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058610]
Predicted Effect probably benign
Transcript: ENSMUST00000058610
AA Change: I80L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049678
Gene: ENSMUSG00000044988
AA Change: I80L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 86 94 N/A INTRINSIC
Pfam:CRF 123 160 2.8e-15 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency 97% (33/34)
MGI Phenotype FUNCTION: This gene encodes a member of the corticotropin-releasing hormone peptide family that participates in coordinating autonomic, endocrine, and behavioral responses to stress. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional hormone. The pancreatic islets isolated from mice lacking the encoded protein secrete less insulin in response to high glucose concentrations. Transgenic mice overexpressing the encoded protein exhibit a metabolically favorable phenotype resisting obesity and hyperglycemia on a high-fat diet. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for one null allele are protected from the hyperinsulinemia, hyperglycemia, glucose intolerance, hepatic steatosis and hypertriglyceridemia induced by a high-fat diet, and show better glucose tolerance as they age. Mice homozygous for another null allele show improved social memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T G 8: 95,003,493 L103V probably null Het
BC051076 C T 5: 87,963,825 noncoding transcript Het
Ccdc191 A T 16: 43,931,198 Q239L probably benign Het
Dennd4b G T 3: 90,271,575 G538* probably null Het
Dusp7 C T 9: 106,369,162 A122V probably benign Het
Exd2 T G 12: 80,484,241 probably benign Het
Fam129b A G 2: 32,923,470 Y565C probably damaging Het
Fam69a T C 5: 107,914,425 D78G possibly damaging Het
Gm10782 C A 13: 56,363,131 noncoding transcript Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Hhipl1 T A 12: 108,318,547 D386E probably benign Het
Hnf1a C T 5: 114,960,011 probably null Het
Ifi204 A G 1: 173,755,632 F340S possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Med26 T C 8: 72,495,632 D541G probably benign Het
Mgam T A 6: 40,686,522 L1218Q probably damaging Het
Msh5 T C 17: 35,045,119 D136G probably damaging Het
Nbl1 C T 4: 139,083,532 C117Y probably damaging Het
Noct T C 3: 51,225,289 probably null Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prmt2 A T 10: 76,208,467 M417K probably damaging Het
Rptor A G 11: 119,857,451 E3G probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc13a5 A G 11: 72,262,076 S60P probably damaging Het
Sycp1 T C 3: 102,925,259 Y197C probably damaging Het
Tmem222 T C 4: 133,271,024 H73R possibly damaging Het
Trmt1l G A 1: 151,439,516 G151D possibly damaging Het
Ttc16 A G 2: 32,768,008 F409L probably benign Het
Ubap2l T C 3: 90,009,132 Q925R probably null Het
Vwa3a T C 7: 120,773,294 S302P probably benign Het
Zfp804b A T 5: 7,179,410 probably benign Het
Zmynd19 A G 2: 24,958,925 E144G possibly damaging Het
Other mutations in Ucn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
confection UTSW 13 3941556 missense probably benign 0.33
R1664:Ucn3 UTSW 13 3941634 missense possibly damaging 0.96
R5288:Ucn3 UTSW 13 3941474 missense probably benign 0.18
R5385:Ucn3 UTSW 13 3941474 missense probably benign 0.18
R5707:Ucn3 UTSW 13 3941556 missense probably benign 0.33
R5954:Ucn3 UTSW 13 3941413 missense probably benign
R6990:Ucn3 UTSW 13 3941295 missense possibly damaging 0.53
R7011:Ucn3 UTSW 13 3941421 missense possibly damaging 0.73
R7215:Ucn3 UTSW 13 3941365 missense probably benign 0.10
R7330:Ucn3 UTSW 13 3941216 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CTCGCAAATTCTTGGCCTTG -3'
(R):5'- ACTTCTGCTGCTCCTAGGAG -3'

Sequencing Primer
(F):5'- CAAATTCTTGGCCTTGTCGATG -3'
(R):5'- TGCTCCTAGGAGGTCCAAG -3'
Posted On2014-11-11