Incidental Mutation 'R0299:Adcy8'
ID24811
Institutional Source Beutler Lab
Gene Symbol Adcy8
Ensembl Gene ENSMUSG00000022376
Gene Nameadenylate cyclase 8
SynonymsAC8
MMRRC Submission 038513-MU
Accession Numbers

Genbank: NM_009623; MGI: 1341110

Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0299 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location64697084-64922296 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64716166 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 894 (D894V)
Ref Sequence ENSEMBL: ENSMUSP00000154029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023007] [ENSMUST00000228014]
Predicted Effect probably damaging
Transcript: ENSMUST00000023007
AA Change: D924V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023007
Gene: ENSMUSG00000022376
AA Change: D924V

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 111 123 N/A INTRINSIC
low complexity region 185 201 N/A INTRINSIC
low complexity region 255 271 N/A INTRINSIC
CYCc 363 565 3.16e-63 SMART
Pfam:DUF1053 615 710 1.3e-30 PFAM
transmembrane domain 741 759 N/A INTRINSIC
transmembrane domain 780 802 N/A INTRINSIC
transmembrane domain 833 852 N/A INTRINSIC
transmembrane domain 857 879 N/A INTRINSIC
low complexity region 900 911 N/A INTRINSIC
CYCc 940 1155 2.19e-48 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228014
AA Change: D894V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.37 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.8%
  • 10x: 95.3%
  • 20x: 90.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adenylate cyclase is a membrane bound enzyme that catalyses the formation of cyclic AMP from ATP. The enzymatic activity is under the control of several hormones, and different polypeptides participate in the transduction of the signal from the receptor to the catalytic moiety. Stimulatory or inhibitory receptors (Rs and Ri) interact with G proteins (Gs and Gi) that exhibit GTPase activity and they modulate the activity of the catalytic subunit of the adenylyl cyclase [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced body size (in female animals only), reduced anxiety, and impaired long term depression (LTD). [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik G A 18: 70,469,482 Q87* probably null Het
4933427I04Rik A T 4: 123,860,822 R176S possibly damaging Het
A2ml1 T G 6: 128,553,232 probably benign Het
Abca13 G A 11: 9,298,076 E2608K probably benign Het
Acpp T C 9: 104,320,002 E146G probably damaging Het
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 A G 12: 79,147,612 D70G probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Carmil1 T A 13: 24,082,020 N253I probably damaging Het
Celf6 C A 9: 59,602,878 T86K probably benign Het
Clec2h T C 6: 128,670,895 V69A probably damaging Het
Col15a1 A T 4: 47,262,950 D534V probably damaging Het
Col16a1 TCCCC TCCC 4: 130,058,318 probably null Het
Degs1 A T 1: 182,279,271 I141N probably damaging Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Dnah8 T A 17: 30,715,509 F1489L possibly damaging Het
Dock10 T C 1: 80,536,929 R1424G probably damaging Het
Elp2 T C 18: 24,634,409 I716T probably benign Het
Frk T C 10: 34,484,371 probably null Het
Fshr C G 17: 89,009,285 S169T probably benign Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gm11596 G A 11: 99,792,944 P117S unknown Het
Gm6327 T C 16: 12,761,197 noncoding transcript Het
Hepacam2 A G 6: 3,476,121 L268P probably damaging Het
Hps6 G A 19: 46,004,232 V203M probably damaging Het
Hsd17b7 G A 1: 169,959,794 probably benign Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Il1r2 T A 1: 40,123,149 Y317* probably null Het
Ints8 C A 4: 11,246,097 V190L probably benign Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Mecom A G 3: 29,980,411 L372P probably benign Het
Mss51 T A 14: 20,484,688 Q338L possibly damaging Het
Muc2 C T 7: 141,752,729 T296I probably damaging Het
Muc4 A T 16: 32,750,195 probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nisch A G 14: 31,171,924 Y1231H probably damaging Het
Olfr1331 A G 4: 118,869,416 I212V probably benign Het
Olfr1338 A T 4: 118,754,535 M1K probably null Het
Pcsk6 T C 7: 66,039,043 V820A probably benign Het
Pdcd10 T C 3: 75,527,651 K111R probably damaging Het
Pdgfrb T A 18: 61,068,852 V496E probably benign Het
Pelo A T 13: 115,088,903 C40* probably null Het
Plxnc1 C T 10: 94,849,821 probably null Het
Ptpru G A 4: 131,803,387 Q519* probably null Het
Pzp A G 6: 128,495,330 probably benign Het
Rad21 A T 15: 51,965,030 D547E probably benign Het
Serpina1d A T 12: 103,765,757 L281Q probably damaging Het
Serpina9 T C 12: 104,001,470 N222S probably benign Het
Sh3bgrl2 A G 9: 83,577,559 K57E probably damaging Het
Shtn1 T C 19: 59,018,951 E289G probably benign Het
Sik3 T C 9: 46,208,740 M659T possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Sppl3 T A 5: 115,088,994 probably benign Het
Suco G A 1: 161,853,810 T253I probably benign Het
Tecta T C 9: 42,352,063 D1409G probably damaging Het
Tram2 T C 1: 21,004,244 D238G probably damaging Het
Trpm3 T C 19: 22,986,873 M1244T possibly damaging Het
Trub1 A G 19: 57,483,625 T178A possibly damaging Het
Ugcg G C 4: 59,217,036 V187L possibly damaging Het
Vmn1r25 T A 6: 57,978,509 Q265L probably damaging Het
Zfp821 G T 8: 109,724,230 R285L probably damaging Het
Other mutations in Adcy8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00589:Adcy8 APN 15 64787367 missense probably damaging 1.00
IGL00690:Adcy8 APN 15 64699302 missense probably damaging 1.00
IGL00990:Adcy8 APN 15 64822313 missense probably benign 0.07
IGL01083:Adcy8 APN 15 64787342 missense probably benign 0.21
IGL01296:Adcy8 APN 15 64783779 missense probably damaging 0.98
IGL01433:Adcy8 APN 15 64737414 missense possibly damaging 0.63
IGL01584:Adcy8 APN 15 64815321 missense probably damaging 1.00
IGL01729:Adcy8 APN 15 64806662 missense probably damaging 1.00
IGL02023:Adcy8 APN 15 64822220 missense probably damaging 1.00
IGL02420:Adcy8 APN 15 64787454 missense probably damaging 1.00
IGL02613:Adcy8 APN 15 64783984 missense possibly damaging 0.82
IGL02662:Adcy8 APN 15 64746895 critical splice donor site probably null
IGL03180:Adcy8 APN 15 64783950 missense possibly damaging 0.77
IGL03327:Adcy8 APN 15 64920267 missense probably damaging 1.00
revolutionary UTSW 15 64699387 missense probably damaging 1.00
whirligig UTSW 15 64699285 missense probably damaging 1.00
F0336:Adcy8 UTSW 15 64822234 missense probably benign 0.38
K7894:Adcy8 UTSW 15 64822234 missense probably benign 0.38
PIT4581001:Adcy8 UTSW 15 64754817 missense probably damaging 1.00
R0035:Adcy8 UTSW 15 64699368 missense probably benign 0.29
R0119:Adcy8 UTSW 15 64716166 missense probably damaging 1.00
R0129:Adcy8 UTSW 15 64747013 missense probably benign 0.18
R0573:Adcy8 UTSW 15 64822195 missense probably damaging 1.00
R0961:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R1203:Adcy8 UTSW 15 64746931 missense probably damaging 1.00
R1239:Adcy8 UTSW 15 64716062 missense probably damaging 0.98
R1615:Adcy8 UTSW 15 64871776 missense probably benign 0.25
R1881:Adcy8 UTSW 15 64806654 missense probably damaging 0.96
R2013:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2014:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2015:Adcy8 UTSW 15 64767878 missense probably benign 0.00
R2164:Adcy8 UTSW 15 64920934 missense probably benign
R2228:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2229:Adcy8 UTSW 15 64822207 missense possibly damaging 0.58
R2241:Adcy8 UTSW 15 64699381 missense possibly damaging 0.78
R3177:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3277:Adcy8 UTSW 15 64699159 missense probably benign 0.10
R3404:Adcy8 UTSW 15 64699600 missense probably damaging 1.00
R3688:Adcy8 UTSW 15 64871707 missense probably damaging 0.99
R3709:Adcy8 UTSW 15 64725535 splice site probably benign
R3710:Adcy8 UTSW 15 64725535 splice site probably benign
R3778:Adcy8 UTSW 15 64746997 missense probably damaging 1.00
R4037:Adcy8 UTSW 15 64725470 missense probably benign 0.06
R4685:Adcy8 UTSW 15 64737438 missense probably benign 0.09
R4731:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4732:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R4733:Adcy8 UTSW 15 64754862 missense possibly damaging 0.91
R5071:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5073:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5074:Adcy8 UTSW 15 64787358 missense probably damaging 1.00
R5091:Adcy8 UTSW 15 64806704 missense probably damaging 1.00
R5285:Adcy8 UTSW 15 64767857 missense possibly damaging 0.68
R5287:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5403:Adcy8 UTSW 15 64716152 missense probably benign 0.04
R5521:Adcy8 UTSW 15 64815350 missense probably damaging 1.00
R5633:Adcy8 UTSW 15 64699285 missense probably damaging 1.00
R5712:Adcy8 UTSW 15 64754866 missense probably damaging 1.00
R5745:Adcy8 UTSW 15 64920471 missense possibly damaging 0.91
R5787:Adcy8 UTSW 15 64704218 missense probably damaging 0.98
R5839:Adcy8 UTSW 15 64716182 missense probably damaging 1.00
R5890:Adcy8 UTSW 15 64815417 missense probably damaging 1.00
R6156:Adcy8 UTSW 15 64817639 unclassified probably null
R6338:Adcy8 UTSW 15 64920617 missense possibly damaging 0.94
R6516:Adcy8 UTSW 15 64699387 missense probably damaging 1.00
R6525:Adcy8 UTSW 15 64737394 nonsense probably null
R6636:Adcy8 UTSW 15 64787402 missense probably damaging 1.00
R6823:Adcy8 UTSW 15 64754886 critical splice acceptor site probably null
R7007:Adcy8 UTSW 15 64704716 missense possibly damaging 0.88
R7070:Adcy8 UTSW 15 64920555 missense probably damaging 1.00
R7092:Adcy8 UTSW 15 64871770 missense possibly damaging 0.93
R7371:Adcy8 UTSW 15 64699218 missense probably benign 0.19
R7457:Adcy8 UTSW 15 64920680 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GAGTAACAGAATTTTCCGAGGGCTCAG -3'
(R):5'- CTATTCCCAGATAGCTTGGCTTCAGAC -3'

Sequencing Primer
(F):5'- CTCAGGATCAGTGTGAGCAG -3'
(R):5'- CAGACCTGTGTCTTCAGATGAG -3'
Posted On2013-04-16