Incidental Mutation 'R2409:Rgs5'
ID248115
Institutional Source Beutler Lab
Gene Symbol Rgs5
Ensembl Gene ENSMUSG00000026678
Gene Nameregulator of G-protein signaling 5
Synonyms
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2409 (G1)
Quality Score224
Status Validated
Chromosome1
Chromosomal Location169655501-169695813 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 169676882 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 34 (V34F)
Ref Sequence ENSEMBL: ENSMUSP00000141496 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027997] [ENSMUST00000152809]
Predicted Effect probably benign
Transcript: ENSMUST00000027997
AA Change: V34F

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027997
Gene: ENSMUSG00000026678
AA Change: V34F

DomainStartEndE-ValueType
low complexity region 42 53 N/A INTRINSIC
RGS 64 180 9.08e-49 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152809
AA Change: V34F

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141496
Gene: ENSMUSG00000026678
AA Change: V34F

DomainStartEndE-ValueType
PDB:1AGR|H 1 73 5e-10 PDB
SCOP:d1dk8a_ 51 71 1e-5 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulators of G protein signaling (RGS) family. The RGS proteins are signal transduction molecules which are involved in the regulation of heterotrimeric G proteins by acting as GTPase activators. This gene is a hypoxia-inducible factor-1 dependent, hypoxia-induced gene which is involved in the induction of endothelial apoptosis. This gene is also one of three genes on chromosome 1q contributing to elevated blood pressure. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a targeted mutation appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Rgs5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01573:Rgs5 APN 1 169676844 missense probably benign
R0024:Rgs5 UTSW 1 169676892 missense probably damaging 0.99
R1334:Rgs5 UTSW 1 169682817 critical splice donor site probably null
R1500:Rgs5 UTSW 1 169690414 critical splice acceptor site probably null
R1753:Rgs5 UTSW 1 169682817 critical splice donor site probably null
R1967:Rgs5 UTSW 1 169676856 missense probably benign
R3831:Rgs5 UTSW 1 169676901 missense probably benign 0.06
R7337:Rgs5 UTSW 1 169655580 start codon destroyed probably null 0.13
R8864:Rgs5 UTSW 1 169690421 missense probably benign
R8960:Rgs5 UTSW 1 169676892 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATGATTGGAACCCACGTGTC -3'
(R):5'- TCTGAGGACTCTGATGATTTTCAG -3'

Sequencing Primer
(F):5'- GGAACCCACGTGTCCTGTTTTC -3'
(R):5'- TGATTTTCAGTGAATAATGGAAGGG -3'
Posted On2014-11-11