Incidental Mutation 'R2409:Vmn2r78'
ID248122
Institutional Source Beutler Lab
Gene Symbol Vmn2r78
Ensembl Gene ENSMUSG00000091962
Gene Namevomeronasal 2, receptor 78
Synonyms
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86915300-86955177 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 86920745 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170835]
Predicted Effect probably benign
Transcript: ENSMUST00000170835
SMART Domains Protein: ENSMUSP00000126698
Gene: ENSMUSG00000091962

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 75 464 5.9e-31 PFAM
Pfam:NCD3G 507 559 8.1e-21 PFAM
Pfam:7tm_3 592 827 1e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Vmn2r78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Vmn2r78 APN 7 86915361 missense unknown
IGL01473:Vmn2r78 APN 7 86920312 missense possibly damaging 0.61
IGL01767:Vmn2r78 APN 7 86954435 missense probably benign 0.28
IGL02322:Vmn2r78 APN 7 86921479 missense probably damaging 0.96
IGL02537:Vmn2r78 APN 7 86954288 missense probably damaging 0.99
IGL03297:Vmn2r78 APN 7 86920761 nonsense probably null
ANU74:Vmn2r78 UTSW 7 86921065 missense possibly damaging 0.62
R0035:Vmn2r78 UTSW 7 86920205 missense probably benign 0.22
R0081:Vmn2r78 UTSW 7 86923027 missense probably benign 0.35
R0401:Vmn2r78 UTSW 7 86921311 missense probably benign 0.04
R0751:Vmn2r78 UTSW 7 86954380 missense possibly damaging 0.77
R1341:Vmn2r78 UTSW 7 86922269 missense possibly damaging 0.71
R1386:Vmn2r78 UTSW 7 86915407 missense unknown
R1526:Vmn2r78 UTSW 7 86922257 splice site probably null
R1712:Vmn2r78 UTSW 7 86954924 missense probably damaging 1.00
R1739:Vmn2r78 UTSW 7 86920789 missense probably benign
R1812:Vmn2r78 UTSW 7 86920787 missense probably benign 0.38
R2011:Vmn2r78 UTSW 7 86955079 missense possibly damaging 0.52
R2144:Vmn2r78 UTSW 7 86954482 missense probably damaging 1.00
R2197:Vmn2r78 UTSW 7 86921327 missense probably damaging 0.96
R2291:Vmn2r78 UTSW 7 86920154 missense probably damaging 1.00
R3023:Vmn2r78 UTSW 7 86954966 missense probably damaging 1.00
R4486:Vmn2r78 UTSW 7 86920751 critical splice acceptor site probably null
R4512:Vmn2r78 UTSW 7 86920244 missense probably benign 0.00
R4515:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R4544:Vmn2r78 UTSW 7 86921191 missense probably benign
R4546:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R4872:Vmn2r78 UTSW 7 86954708 missense possibly damaging 0.87
R4928:Vmn2r78 UTSW 7 86954627 missense probably damaging 1.00
R5101:Vmn2r78 UTSW 7 86922355 missense probably damaging 1.00
R5265:Vmn2r78 UTSW 7 86920124 missense probably damaging 1.00
R5328:Vmn2r78 UTSW 7 86921030 missense probably damaging 0.98
R5442:Vmn2r78 UTSW 7 86920122 missense possibly damaging 0.95
R5567:Vmn2r78 UTSW 7 86921529 missense probably benign 0.17
R5572:Vmn2r78 UTSW 7 86915512 missense probably benign 0.01
R5636:Vmn2r78 UTSW 7 86954429 missense probably damaging 0.99
R5901:Vmn2r78 UTSW 7 86954588 missense probably damaging 1.00
R5977:Vmn2r78 UTSW 7 86920333 missense possibly damaging 0.74
R5977:Vmn2r78 UTSW 7 86954907 missense probably benign 0.00
R6276:Vmn2r78 UTSW 7 86921110 missense probably benign 0.00
R6386:Vmn2r78 UTSW 7 86922337 nonsense probably null
R6724:Vmn2r78 UTSW 7 86954258 missense probably damaging 0.99
R6852:Vmn2r78 UTSW 7 86954603 missense probably damaging 1.00
R6896:Vmn2r78 UTSW 7 86922350 missense probably benign 0.10
R7385:Vmn2r78 UTSW 7 86922425 missense probably benign 0.18
R7578:Vmn2r78 UTSW 7 86954344 nonsense probably null
R7680:Vmn2r78 UTSW 7 86954941 missense probably damaging 1.00
R7748:Vmn2r78 UTSW 7 86921135 missense probably benign 0.00
R7852:Vmn2r78 UTSW 7 86920170 nonsense probably null
R8031:Vmn2r78 UTSW 7 86954867 missense probably damaging 1.00
R8070:Vmn2r78 UTSW 7 86922487 missense probably benign 0.01
R8085:Vmn2r78 UTSW 7 86954790 missense probably benign 0.00
R8163:Vmn2r78 UTSW 7 86954452 missense probably damaging 1.00
R8501:Vmn2r78 UTSW 7 86920886 missense probably damaging 0.99
R8749:Vmn2r78 UTSW 7 86954305 missense possibly damaging 0.81
RF018:Vmn2r78 UTSW 7 86954431 nonsense probably null
Z1177:Vmn2r78 UTSW 7 86921207 missense probably benign 0.44
Z1177:Vmn2r78 UTSW 7 86954774 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTTTATGACAAATGGGCAGGAG -3'
(R):5'- AACTGAATTCCATGGTCATCATCTG -3'

Sequencing Primer
(F):5'- GGCAGGAGAAACAACATAATGTTAG -3'
(R):5'- ATCTGTAATGATGACTCCTACCCAG -3'
Posted On2014-11-11