Mutagenetix > Incidental Mutation

Incidental Mutation 'R2409:Septin1'

248124

Institutional Source

Beutler Lab

Gene Symbol

Septin1

Ensembl Gene

ENSMUSG00000000486

Gene Name

septin 1

Synonyms

Sept1, Diff6, PNUTL3

MMRRC Submission

040375-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.251) question?

Stock #

R2409 (G1)

Quality Score

214

Status

Validated

Chromosome

Chromosomal Location

126813619-126832302 bp(-) (GRCm39)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 126815143 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000114468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032910] [ENSMUST00000106313] [ENSMUST00000106314] [ENSMUST00000127710] [ENSMUST00000142356] [ENSMUST00000142356] [ENSMUST00000206204] [ENSMUST00000152267] [ENSMUST00000206772] [ENSMUST00000133913]

AlphaFold

P42209

Predicted Effect

probably benign
Transcript: ENSMUST00000032910

SMART Domains

Protein: ENSMUSP00000032910
Gene: ENSMUSG00000030672

Domain	Start	End	E-Value	Type
EFh	29	57	9.77e-5	SMART
EFh	99	127	4.45e1	SMART
Blast:EFh	135	163	2e-11	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000106313

SMART Domains

Protein: ENSMUSP00000101920
Gene: ENSMUSG00000000486

Domain	Start	End	E-Value	Type
Pfam:DUF258	1	74	4.2e-8	PFAM
Pfam:MMR_HSR1	1	200	5.7e-8	PFAM
Pfam:Septin	1	274	5.7e-120	PFAM
coiled coil region	297	336	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000106314

SMART Domains

Protein: ENSMUSP00000101921
Gene: ENSMUSG00000000486

Domain	Start	End	E-Value	Type
Pfam:Septin	22	302	3.9e-124	PFAM
Pfam:MMR_HSR1	27	171	6.2e-9	PFAM
low complexity region	349	363	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127710

SMART Domains

Protein: ENSMUSP00000120915
Gene: ENSMUSG00000030672

Domain	Start	End	E-Value	Type
Pfam:EF-hand_8	7	34	9.7e-3	PFAM
Pfam:EF-hand_1	9	37	1.6e-6	PFAM
Pfam:EF-hand_6	9	38	1.6e-6	PFAM
Pfam:EF-hand_8	21	54	5.1e-4	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131208

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133591

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133733

Predicted Effect

probably null
Transcript: ENSMUST00000142356

SMART Domains

Protein: ENSMUSP00000114468
Gene: ENSMUSG00000000486

Domain	Start	End	E-Value	Type
Pfam:DUF258	1	74	1.4e-8	PFAM
Pfam:MMR_HSR1	1	172	1.4e-8	PFAM
Pfam:Septin	1	186	3.1e-80	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000142356

SMART Domains

Protein: ENSMUSP00000114468
Gene: ENSMUSG00000000486

Domain	Start	End	E-Value	Type
Pfam:DUF258	1	74	1.4e-8	PFAM
Pfam:MMR_HSR1	1	172	1.4e-8	PFAM
Pfam:Septin	1	186	3.1e-80	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143222

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138541

Predicted Effect

probably benign
Transcript: ENSMUST00000206204

Predicted Effect

probably benign
Transcript: ENSMUST00000152267

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139613

Predicted Effect

probably benign
Transcript: ENSMUST00000206772

Predicted Effect

probably benign
Transcript: ENSMUST00000133913

Meta Mutation Damage Score

0.9485

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 94.0%

Validation Efficiency

100% (32/32)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	C	T	5: 8,788,747 (GRCm39)	T1042I	probably benign	Het
Adamts13	A	G	2: 26,868,374 (GRCm39)	T162A	probably benign	Het
Adamts7	T	A	9: 90,062,740 (GRCm39)	I398N	probably damaging	Het
Cib2	A	G	9: 54,452,751 (GRCm39)		probably null	Het
Cyp3a16	T	C	5: 145,377,177 (GRCm39)	K470R	probably benign	Het
Dpy19l2	A	G	9: 24,569,924 (GRCm39)	M343T	probably benign	Het
Dyrk2	A	G	10: 118,696,532 (GRCm39)	V242A	probably benign	Het
Extl3	T	C	14: 65,315,017 (GRCm39)	D55G	probably benign	Het
Fabp7	A	G	10: 57,661,772 (GRCm39)	K82E	possibly damaging	Het
Fat1	G	T	8: 45,493,567 (GRCm39)		probably benign	Het
Gen1	A	G	12: 11,299,165 (GRCm39)	I280T	possibly damaging	Het
Gm5117	T	C	8: 32,227,306 (GRCm39)		noncoding transcript	Het
Gucy1b2	CCGTGTTT	C	14: 62,643,628 (GRCm39)		probably null	Het
Il3ra	G	A	14: 14,349,377 (GRCm38)		probably null	Het
Myo1f	A	G	17: 33,795,641 (GRCm39)	N66D	probably damaging	Het
Nfkb1	C	T	3: 135,319,704 (GRCm39)	E264K	possibly damaging	Het
Nsf	C	T	11: 103,821,578 (GRCm39)	E26K	possibly damaging	Het
Or7d10	G	T	9: 19,832,072 (GRCm39)	R189L	probably benign	Het
Or7d10	G	C	9: 19,832,077 (GRCm39)	D191H	probably damaging	Het
Prdm10	A	G	9: 31,260,418 (GRCm39)	H624R	possibly damaging	Het
Rgs5	G	T	1: 169,504,451 (GRCm39)	V34F	possibly damaging	Het
Sec14l4	T	C	11: 3,990,048 (GRCm39)	S116P	probably benign	Het
Septin9	T	A	11: 117,251,287 (GRCm39)	I535N	probably damaging	Het
Sh2b1	C	T	7: 126,070,651 (GRCm39)	G350D	probably damaging	Het
Slc6a21	T	C	7: 44,929,750 (GRCm39)	V107A	probably benign	Het
Trim26	C	A	17: 37,161,895 (GRCm39)	H105N	probably damaging	Het
Trim71	A	T	9: 114,342,781 (GRCm39)	D500E	possibly damaging	Het
Vmn2r78	T	A	7: 86,569,953 (GRCm39)		probably benign	Het
Vmn2r84	A	G	10: 130,227,940 (GRCm39)	S99P	probably damaging	Het

Other mutations in Septin1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0675:Septin1	UTSW	7	126,816,171 (GRCm39)	missense	probably damaging	0.99
R1375:Septin1	UTSW	7	126,817,333 (GRCm39)	missense	probably damaging	1.00
R1627:Septin1	UTSW	7	126,817,230 (GRCm39)	critical splice acceptor site	probably null
R1886:Septin1	UTSW	7	126,813,937 (GRCm39)	unclassified	probably benign
R3872:Septin1	UTSW	7	126,814,447 (GRCm39)	unclassified	probably benign
R4320:Septin1	UTSW	7	126,816,200 (GRCm39)	missense	probably damaging	1.00
R4321:Septin1	UTSW	7	126,816,200 (GRCm39)	missense	probably damaging	1.00
R4323:Septin1	UTSW	7	126,816,200 (GRCm39)	missense	probably damaging	1.00
R4864:Septin1	UTSW	7	126,816,064 (GRCm39)	unclassified	probably benign
R5605:Septin1	UTSW	7	126,814,598 (GRCm39)	missense	probably damaging	1.00
R6838:Septin1	UTSW	7	126,815,894 (GRCm39)	missense	probably benign	0.01
R6870:Septin1	UTSW	7	126,816,876 (GRCm39)	missense	probably benign	0.25
R7030:Septin1	UTSW	7	126,816,157 (GRCm39)	missense	probably benign	0.12
R7494:Septin1	UTSW	7	126,814,122 (GRCm39)	missense	probably damaging	0.98
R7797:Septin1	UTSW	7	126,813,937 (GRCm39)	missense	unknown
R8002:Septin1	UTSW	7	126,815,074 (GRCm39)	missense	probably damaging	1.00
R9190:Septin1	UTSW	7	126,816,092 (GRCm39)	missense	probably benign	0.11
X0021:Septin1	UTSW	7	126,814,525 (GRCm39)	missense	possibly damaging	0.94
Z1177:Septin1	UTSW	7	126,816,074 (GRCm39)	missense	possibly damaging	0.84
Z1177:Septin1	UTSW	7	126,815,135 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AGTCACGTTGGCTCATCCTG -3'
(R):5'- AAAGTGCTTTCCCACGGACC -3'

Sequencing Primer
(F):5'- GGGCATAATCCTCTTTCTCAGC -3'
(R):5'- GGACCTCACTTTATAGACCAGGCTG -3'

Posted On

2014-11-11