Incidental Mutation 'R2409:Sept1'
ID248124
Institutional Source Beutler Lab
Gene Symbol Sept1
Ensembl Gene ENSMUSG00000000486
Gene Nameseptin 1
SynonymsPNUTL3, Diff6
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.315) question?
Stock #R2409 (G1)
Quality Score214
Status Validated
Chromosome7
Chromosomal Location127214447-127233130 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 127215971 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032910] [ENSMUST00000106313] [ENSMUST00000106314] [ENSMUST00000127710] [ENSMUST00000133913] [ENSMUST00000142356] [ENSMUST00000142356] [ENSMUST00000206204] [ENSMUST00000152267] [ENSMUST00000206772]
Predicted Effect probably benign
Transcript: ENSMUST00000032910
SMART Domains Protein: ENSMUSP00000032910
Gene: ENSMUSG00000030672

DomainStartEndE-ValueType
EFh 29 57 9.77e-5 SMART
EFh 99 127 4.45e1 SMART
Blast:EFh 135 163 2e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000106313
SMART Domains Protein: ENSMUSP00000101920
Gene: ENSMUSG00000000486

DomainStartEndE-ValueType
Pfam:DUF258 1 74 4.2e-8 PFAM
Pfam:MMR_HSR1 1 200 5.7e-8 PFAM
Pfam:Septin 1 274 5.7e-120 PFAM
coiled coil region 297 336 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106314
SMART Domains Protein: ENSMUSP00000101921
Gene: ENSMUSG00000000486

DomainStartEndE-ValueType
Pfam:Septin 22 302 3.9e-124 PFAM
Pfam:MMR_HSR1 27 171 6.2e-9 PFAM
low complexity region 349 363 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127710
SMART Domains Protein: ENSMUSP00000120915
Gene: ENSMUSG00000030672

DomainStartEndE-ValueType
Pfam:EF-hand_8 7 34 9.7e-3 PFAM
Pfam:EF-hand_1 9 37 1.6e-6 PFAM
Pfam:EF-hand_6 9 38 1.6e-6 PFAM
Pfam:EF-hand_8 21 54 5.1e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131208
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133733
Predicted Effect probably benign
Transcript: ENSMUST00000133913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138541
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139613
Predicted Effect probably null
Transcript: ENSMUST00000142356
SMART Domains Protein: ENSMUSP00000114468
Gene: ENSMUSG00000000486

DomainStartEndE-ValueType
Pfam:DUF258 1 74 1.4e-8 PFAM
Pfam:MMR_HSR1 1 172 1.4e-8 PFAM
Pfam:Septin 1 186 3.1e-80 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000142356
SMART Domains Protein: ENSMUSP00000114468
Gene: ENSMUSG00000000486

DomainStartEndE-ValueType
Pfam:DUF258 1 74 1.4e-8 PFAM
Pfam:MMR_HSR1 1 172 1.4e-8 PFAM
Pfam:Septin 1 186 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143222
Predicted Effect probably benign
Transcript: ENSMUST00000206204
Predicted Effect probably benign
Transcript: ENSMUST00000152267
Predicted Effect probably benign
Transcript: ENSMUST00000206772
Meta Mutation Damage Score 0.9485 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Sept1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0675:Sept1 UTSW 7 127216999 missense probably damaging 0.99
R1375:Sept1 UTSW 7 127218161 missense probably damaging 1.00
R1627:Sept1 UTSW 7 127218058 critical splice acceptor site probably null
R1886:Sept1 UTSW 7 127214765 unclassified probably benign
R3872:Sept1 UTSW 7 127215275 unclassified probably benign
R4320:Sept1 UTSW 7 127217028 missense probably damaging 1.00
R4321:Sept1 UTSW 7 127217028 missense probably damaging 1.00
R4323:Sept1 UTSW 7 127217028 missense probably damaging 1.00
R4864:Sept1 UTSW 7 127216892 unclassified probably benign
R5605:Sept1 UTSW 7 127215426 missense probably damaging 1.00
R6838:Sept1 UTSW 7 127216722 missense probably benign 0.01
R6870:Sept1 UTSW 7 127217704 missense probably benign 0.25
R7030:Sept1 UTSW 7 127216985 missense probably benign 0.12
R7494:Sept1 UTSW 7 127214950 missense probably damaging 0.98
R7797:Sept1 UTSW 7 127214765 missense unknown
R8002:Sept1 UTSW 7 127215902 missense probably damaging 1.00
X0021:Sept1 UTSW 7 127215353 missense possibly damaging 0.94
Z1177:Sept1 UTSW 7 127215963 missense possibly damaging 0.93
Z1177:Sept1 UTSW 7 127216902 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGTCACGTTGGCTCATCCTG -3'
(R):5'- AAAGTGCTTTCCCACGGACC -3'

Sequencing Primer
(F):5'- GGGCATAATCCTCTTTCTCAGC -3'
(R):5'- GGACCTCACTTTATAGACCAGGCTG -3'
Posted On2014-11-11