Incidental Mutation 'R2409:Gm5117'
ID248125
Institutional Source Beutler Lab
Gene Symbol Gm5117
Ensembl Gene ENSMUSG00000093862
Gene Namepredicted gene 5117
Synonyms
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location31737208-31739760 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 31737278 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178878
SMART Domains Protein: ENSMUSP00000137046
Gene: ENSMUSG00000093862

DomainStartEndE-ValueType
low complexity region 147 158 N/A INTRINSIC
low complexity region 608 627 N/A INTRINSIC
Pfam:Met_10 666 799 1.5e-9 PFAM
Pfam:UPF0020 672 770 4e-8 PFAM
Pfam:Methyltransf_18 687 815 5e-10 PFAM
Pfam:Methyltransf_31 688 801 1.5e-10 PFAM
Pfam:Methyltransf_26 688 803 1e-8 PFAM
Pfam:Methyltransf_15 688 842 5e-48 PFAM
Meta Mutation Damage Score 0.4383 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Gm5117
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Gm5117 APN 8 31738487 exon noncoding transcript
IGL01362:Gm5117 APN 8 31737919 exon noncoding transcript
IGL01972:Gm5117 APN 8 31737759 exon noncoding transcript
IGL02100:Gm5117 APN 8 31737384 exon noncoding transcript
IGL02339:Gm5117 APN 8 31738226 exon noncoding transcript
IGL02366:Gm5117 APN 8 31737859 exon noncoding transcript
IGL02505:Gm5117 APN 8 31738316 exon noncoding transcript
IGL02698:Gm5117 APN 8 31739739 exon noncoding transcript
IGL03310:Gm5117 APN 8 31738808 exon noncoding transcript
IGL02835:Gm5117 UTSW 8 31737170 unclassified noncoding transcript
R1816:Gm5117 UTSW 8 31738958 exon noncoding transcript
R2157:Gm5117 UTSW 8 31738194 exon noncoding transcript
R2353:Gm5117 UTSW 8 31739195 exon noncoding transcript
R2404:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2408:Gm5117 UTSW 8 31737278 exon noncoding transcript
R2510:Gm5117 UTSW 8 31738355 exon noncoding transcript
R4686:Gm5117 UTSW 8 31739256 exon noncoding transcript
R4953:Gm5117 UTSW 8 31738580 exon noncoding transcript
R5244:Gm5117 UTSW 8 31738277 exon noncoding transcript
R5275:Gm5117 UTSW 8 31739567 exon noncoding transcript
R5329:Gm5117 UTSW 8 31737882 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCATTAGCGTCCTTTAAAACTCGG -3'
(R):5'- TGCTACTGCAGAGACCTTCG -3'

Sequencing Primer
(F):5'- GGGAGTTTTCCACATCACATG -3'
(R):5'- TACTGCAGAGACCTTCGACATTAGG -3'
Posted On2014-11-11