Incidental Mutation 'R2409:Olfr77'
ID248128
Institutional Source Beutler Lab
Gene Symbol Olfr77
Ensembl Gene ENSMUSG00000051118
Gene Nameolfactory receptor 77
SynonymsMOR143-1, 18A, GA_x6K02T2PVTD-13660026-13660964
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location19916865-19929124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 19920781 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Histidine at position 191 (D191H)
Ref Sequence ENSEMBL: ENSMUSP00000149055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057596] [ENSMUST00000217347]
Predicted Effect probably damaging
Transcript: ENSMUST00000057596
AA Change: D191H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058810
Gene: ENSMUSG00000051118
AA Change: D191H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3e-53 PFAM
Pfam:7tm_1 41 290 1.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217347
AA Change: D191H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Olfr77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Olfr77 APN 9 19920949 missense possibly damaging 0.87
IGL01318:Olfr77 APN 9 19920758 missense probably benign 0.44
IGL01547:Olfr77 APN 9 19920901 missense probably benign 0.00
IGL01635:Olfr77 APN 9 19920484 missense probably damaging 1.00
IGL02112:Olfr77 APN 9 19920525 missense possibly damaging 0.48
IGL02858:Olfr77 APN 9 19920451 missense probably damaging 0.99
IGL02904:Olfr77 APN 9 19921097 missense probably damaging 1.00
IGL02956:Olfr77 APN 9 19921052 missense possibly damaging 0.87
IGL03066:Olfr77 APN 9 19920371 missense probably benign 0.12
R0662:Olfr77 UTSW 9 19920500 missense probably damaging 1.00
R1222:Olfr77 UTSW 9 19921048 missense possibly damaging 0.87
R1572:Olfr77 UTSW 9 19920912 missense probably benign 0.35
R1761:Olfr77 UTSW 9 19921149 makesense probably null
R2409:Olfr77 UTSW 9 19920776 missense probably benign 0.31
R3621:Olfr77 UTSW 9 19920913 missense probably damaging 0.99
R3849:Olfr77 UTSW 9 19920809 missense probably damaging 1.00
R3850:Olfr77 UTSW 9 19920809 missense probably damaging 1.00
R4277:Olfr77 UTSW 9 19920389 missense possibly damaging 0.91
R4768:Olfr77 UTSW 9 19920545 missense possibly damaging 0.56
R4979:Olfr77 UTSW 9 19920359 missense probably benign 0.03
R5276:Olfr77 UTSW 9 19920621 missense possibly damaging 0.87
R5503:Olfr77 UTSW 9 19920379 missense probably benign 0.36
R5760:Olfr77 UTSW 9 19920754 missense probably benign 0.00
R5778:Olfr77 UTSW 9 19921041 missense probably benign 0.20
R5930:Olfr77 UTSW 9 19920910 missense probably damaging 0.99
R6012:Olfr77 UTSW 9 19920941 missense probably damaging 0.99
R7269:Olfr77 UTSW 9 19920335 missense possibly damaging 0.95
R7977:Olfr77 UTSW 9 19920314 missense possibly damaging 0.48
R7987:Olfr77 UTSW 9 19920314 missense possibly damaging 0.48
R8174:Olfr77 UTSW 9 19920724 missense probably damaging 1.00
Z1088:Olfr77 UTSW 9 19920712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATGAACCCTCGAATCTGTG -3'
(R):5'- TGAATGGGCTACAGCAGAAC -3'

Sequencing Primer
(F):5'- CTCGAATCTGTGGCCTTCTGG -3'
(R):5'- TGAGATGAACTACAAATCCTGTCC -3'
Posted On2014-11-11