Incidental Mutation 'R2409:Dpy19l2'
ID248129
Institutional Source Beutler Lab
Gene Symbol Dpy19l2
Ensembl Gene ENSMUSG00000085576
Gene Namedpy-19-like 2 (C. elegans)
Synonyms
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location24557047-24696293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24658628 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 343 (M343T)
Ref Sequence ENSEMBL: ENSMUSP00000132092 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000133010]
Predicted Effect probably benign
Transcript: ENSMUST00000133010
AA Change: M343T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132092
Gene: ENSMUSG00000085576
AA Change: M343T

DomainStartEndE-ValueType
Pfam:Dpy19 129 772 3.1e-233 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dpy-19 family. It is highly expressed in testis, and is required for sperm head elongation and acrosome formation during spermatogenesis. Mutations in this gene are associated with an infertility disorder, spermatogenic failure type 9 (SPGF9). [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male sterility associated with globozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Dpy19l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Dpy19l2 APN 9 24582818 missense probably damaging 1.00
IGL01137:Dpy19l2 APN 9 24658562 missense possibly damaging 0.78
IGL01586:Dpy19l2 APN 9 24666975 missense probably benign 0.16
IGL02245:Dpy19l2 APN 9 24696025 missense probably benign
IGL02507:Dpy19l2 APN 9 24631267 missense probably benign 0.01
IGL02541:Dpy19l2 APN 9 24658647 missense probably benign 0.00
IGL02644:Dpy19l2 APN 9 24658592 missense probably damaging 1.00
IGL03144:Dpy19l2 APN 9 24646307 missense possibly damaging 0.92
Deferential UTSW 9 24695814 missense probably benign 0.41
polite UTSW 9 24660743 missense possibly damaging 0.91
BB004:Dpy19l2 UTSW 9 24695901 missense probably benign 0.00
BB014:Dpy19l2 UTSW 9 24695901 missense probably benign 0.00
R0022:Dpy19l2 UTSW 9 24696124 missense probably benign
R0029:Dpy19l2 UTSW 9 24558101 missense probably damaging 0.97
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0066:Dpy19l2 UTSW 9 24646383 splice site probably benign
R0089:Dpy19l2 UTSW 9 24695793 missense probably benign 0.01
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0240:Dpy19l2 UTSW 9 24658580 missense probably damaging 1.00
R0349:Dpy19l2 UTSW 9 24695922 missense possibly damaging 0.89
R0491:Dpy19l2 UTSW 9 24696028 missense probably benign 0.09
R0519:Dpy19l2 UTSW 9 24558095 missense probably benign 0.30
R1398:Dpy19l2 UTSW 9 24581263 splice site probably benign
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1465:Dpy19l2 UTSW 9 24669322 missense probably benign 0.04
R1576:Dpy19l2 UTSW 9 24584502 missense probably benign
R1606:Dpy19l2 UTSW 9 24581215 missense probably benign
R2157:Dpy19l2 UTSW 9 24584632 missense probably benign 0.00
R2157:Dpy19l2 UTSW 9 24680780 missense probably benign 0.02
R2402:Dpy19l2 UTSW 9 24581248 missense probably damaging 1.00
R3196:Dpy19l2 UTSW 9 24695989 missense probably damaging 1.00
R3419:Dpy19l2 UTSW 9 24581205 missense probably damaging 1.00
R4884:Dpy19l2 UTSW 9 24628180 nonsense probably null
R5289:Dpy19l2 UTSW 9 24695997 missense probably benign
R5950:Dpy19l2 UTSW 9 24581134 missense probably benign 0.10
R6470:Dpy19l2 UTSW 9 24660743 missense possibly damaging 0.91
R7028:Dpy19l2 UTSW 9 24628251 missense probably benign 0.15
R7051:Dpy19l2 UTSW 9 24584493 missense probably benign 0.00
R7095:Dpy19l2 UTSW 9 24695814 missense probably benign 0.41
R7649:Dpy19l2 UTSW 9 24696163 start codon destroyed probably null 0.53
R7927:Dpy19l2 UTSW 9 24695901 missense probably benign 0.00
R7936:Dpy19l2 UTSW 9 24558158 missense probably damaging 1.00
R8076:Dpy19l2 UTSW 9 24680692 missense probably damaging 1.00
R8259:Dpy19l2 UTSW 9 24669406 missense probably benign 0.08
R8473:Dpy19l2 UTSW 9 24581230 missense probably benign
X0067:Dpy19l2 UTSW 9 24585537 missense probably benign 0.00
Z1088:Dpy19l2 UTSW 9 24660824 splice site probably null
Z1177:Dpy19l2 UTSW 9 24646359 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GCCCTGAAAGCATAAGTGAAATC -3'
(R):5'- CTTCGGCTGGAGAATTAAAAGTG -3'

Sequencing Primer
(F):5'- TATCACAAGTTCAAGGCTAGCTCGG -3'
(R):5'- ATTCAATTTCCTGAGTACTCGTTTG -3'
Posted On2014-11-11