Incidental Mutation 'R2409:Cib2'
ID248131
Institutional Source Beutler Lab
Gene Symbol Cib2
Ensembl Gene ENSMUSG00000037493
Gene Namecalcium and integrin binding family member 2
Synonymscalcium binding protein Kip2, 2810434I23Rik
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location54544794-54560218 bp(-) (GRCm38)
Type of Mutationunclassified (1813 bp from exon)
DNA Base Change (assembly) A to G at 54545467 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041901] [ENSMUST00000060242] [ENSMUST00000118413]
Predicted Effect probably damaging
Transcript: ENSMUST00000041901
AA Change: I187T

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038527
Gene: ENSMUSG00000037493
AA Change: I187T

DomainStartEndE-ValueType
EFh 73 98 8.33e1 SMART
EFh 107 135 5.38e0 SMART
EFh 148 176 3.3e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000060242
SMART Domains Protein: ENSMUSP00000053690
Gene: ENSMUSG00000046460

DomainStartEndE-ValueType
Blast:SH2 1 51 7e-6 BLAST
low complexity region 165 176 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118413
SMART Domains Protein: ENSMUSP00000113298
Gene: ENSMUSG00000046460

DomainStartEndE-ValueType
Blast:SH2 1 51 7e-6 BLAST
low complexity region 165 176 N/A INTRINSIC
Meta Mutation Damage Score 0.1992 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to that of KIP/CIB, calcineurin B, and calmodulin. The encoded protein is a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs), and it is involved in photoreceptor cell maintenance. Mutations in this gene cause deafness, autosomal recessive, 48 (DFNB48), and also Usher syndrome 1J (USH1J). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Cib2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Cib2 APN 9 54549886 missense probably damaging 0.97
IGL01868:Cib2 APN 9 54548475 missense probably damaging 0.98
IGL02350:Cib2 APN 9 54549886 missense probably damaging 0.97
IGL02357:Cib2 APN 9 54549886 missense probably damaging 0.97
IGL02656:Cib2 APN 9 54545898 missense probably damaging 1.00
PIT4377001:Cib2 UTSW 9 54559987 missense probably damaging 0.96
R0617:Cib2 UTSW 9 54554496 missense possibly damaging 0.71
R1670:Cib2 UTSW 9 54548369 missense probably damaging 1.00
R4790:Cib2 UTSW 9 54549803 unclassified probably null
R4910:Cib2 UTSW 9 54549879 missense probably benign 0.34
R6823:Cib2 UTSW 9 54549891 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCACAACCCTGTTGCAGTTAG -3'
(R):5'- GTGGTTTAGACCCTTCTAGCTG -3'

Sequencing Primer
(F):5'- GGAAATGTCCATGGGTGA -3'
(R):5'- CTAGCTGAAAACTGGATAGCTGCTC -3'
Posted On2014-11-11