Incidental Mutation 'R2409:Trim71'
ID248133
Institutional Source Beutler Lab
Gene Symbol Trim71
Ensembl Gene ENSMUSG00000079259
Gene Nametripartite motif-containing 71
SynonymsmLin41, 636931, Lin41, 2610206G21Rik, LOC382112, lin-41, mlin-41
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location114507133-114564369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 114513713 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 500 (D500E)
Ref Sequence ENSEMBL: ENSMUSP00000107447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111816] [ENSMUST00000180393]
Predicted Effect possibly damaging
Transcript: ENSMUST00000111816
AA Change: D500E

PolyPhen 2 Score 0.887 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107447
Gene: ENSMUSG00000079259
AA Change: D500E

DomainStartEndE-ValueType
RING 12 93 7.16e-6 SMART
low complexity region 129 176 N/A INTRINSIC
BBOX 181 230 1.49e-1 SMART
BBOX 260 301 4.54e-8 SMART
Blast:BBC 325 433 1e-9 BLAST
IG_FLMN 470 570 5.04e-24 SMART
Pfam:NHL 593 620 2.9e-12 PFAM
Pfam:NHL 640 667 1.8e-9 PFAM
Pfam:NHL 687 714 4.4e-12 PFAM
Pfam:NHL 734 761 1.4e-10 PFAM
Pfam:NHL 781 808 4.4e-12 PFAM
Pfam:NHL 828 855 8.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000180393
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that binds with miRNAs and maintains the growth and upkeep of embryonic stem cells. This gene also is involved in the G1-S phase transition of the cell cycle. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous gene trap mutations of this gene result in failure of cranial neural tube closure and embryonic lethality. Homozygotes for a gene trap allele exhibit exencephaly, abnormal nasal process and facial prominence, reduced brain size, and embryonic or fetal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Trim71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Trim71 APN 9 114525015 missense probably benign 0.19
IGL02060:Trim71 APN 9 114513253 missense possibly damaging 0.55
R1858:Trim71 UTSW 9 114562948 missense possibly damaging 0.86
R2161:Trim71 UTSW 9 114512772 missense probably damaging 1.00
R3034:Trim71 UTSW 9 114512844 missense probably damaging 1.00
R3843:Trim71 UTSW 9 114515846 missense probably benign 0.00
R6786:Trim71 UTSW 9 114512704 missense probably benign 0.05
R6846:Trim71 UTSW 9 114525047 missense probably damaging 1.00
R7524:Trim71 UTSW 9 114513162 missense probably benign 0.35
R7559:Trim71 UTSW 9 114513042 missense probably damaging 1.00
R7590:Trim71 UTSW 9 114562825 missense probably benign 0.02
R7922:Trim71 UTSW 9 114513085 missense probably damaging 1.00
R8156:Trim71 UTSW 9 114513124 missense probably benign 0.14
R8371:Trim71 UTSW 9 114515789 missense probably benign 0.22
R8756:Trim71 UTSW 9 114513537 missense possibly damaging 0.62
X0065:Trim71 UTSW 9 114513115 missense probably benign 0.07
Z1177:Trim71 UTSW 9 114513481 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGGGGCTGTTCTCTATATGC -3'
(R):5'- TGCAGGAGCTCAAGACCATC -3'

Sequencing Primer
(F):5'- GCTGATTGTACAATGTCACCGAC -3'
(R):5'- CCCAAGAAGATGACCGCATTATGTTC -3'
Posted On2014-11-11