Incidental Mutation 'R2409:Fabp7'
ID248135
Institutional Source Beutler Lab
Gene Symbol Fabp7
Ensembl Gene ENSMUSG00000019874
Gene Namefatty acid binding protein 7, brain
SynonymsBFABP, Blbp, B-FABP
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location57784881-57788450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57785676 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 82 (K82E)
Ref Sequence ENSEMBL: ENSMUSP00000131415 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020024] [ENSMUST00000165013]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020024
AA Change: K82E

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020024
Gene: ENSMUSG00000019874
AA Change: K82E

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 132 4.6e-10 PFAM
Pfam:Lipocalin 7 132 4.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000165013
AA Change: K82E

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131415
Gene: ENSMUSG00000019874
AA Change: K82E

DomainStartEndE-ValueType
Pfam:Lipocalin_7 3 125 4.7e-10 PFAM
Pfam:Lipocalin 7 123 8.4e-26 PFAM
low complexity region 129 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177265
Meta Mutation Damage Score 0.4185 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a small, highly conserved cytoplasmic protein that bind long-chain fatty acids and other hydrophobic ligands. The encoded protein is important in the establishment of the radial glial fiber in the developing brain. Alternative splicing and promoter usage results in multiple transcript variants encoding different isoforms. Pseudogenes of this gene are found on multiple chromosomes. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased fear memory, increased anxiety, and decreased sensitivity to DHA-induced NMDA currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Fabp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0571:Fabp7 UTSW 10 57785541 missense probably benign 0.01
R4835:Fabp7 UTSW 10 57785580 missense possibly damaging 0.80
R7206:Fabp7 UTSW 10 57784991 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGTTGCTGTTAACTGCGCTG -3'
(R):5'- GATAAATAGCCTGCAAGTTTGGC -3'

Sequencing Primer
(F):5'- GTTAACTGCGCTGGCTCC -3'
(R):5'- CCTGCAAGTTTGGCTCTGGAAATTAC -3'
Posted On2014-11-11