Mutagenetix > Incidental Mutations

Incidental Mutation 'R2409:Vmn2r84'

248137

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r84

Ensembl Gene

ENSMUSG00000070601

Gene Name

vomeronasal 2, receptor 84

Synonyms

EG625068

MMRRC Submission

040375-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R2409 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

130385316-130394241 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 130392071 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 99 (S99P)

Ref Sequence

ENSEMBL: ENSMUSP00000092079 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094502]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094502
AA Change: S99P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000092079
Gene: ENSMUSG00000070601
AA Change: S99P

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	77	448	1.3e-27	PFAM
Pfam:NCD3G	508	561	6.9e-21	PFAM
Pfam:7tm_3	594	830	4.6e-55	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.9%
20x: 94.0%

Validation Efficiency

100% (32/32)

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1a	C	T	5: 8,738,747	T1042I	probably benign	Het
Adamts13	A	G	2: 26,978,362	T162A	probably benign	Het
Adamts7	T	A	9: 90,180,687	I398N	probably damaging	Het
Cib2	A	G	9: 54,545,467		probably null	Het
Cyp3a16	T	C	5: 145,440,367	K470R	probably benign	Het
Dpy19l2	A	G	9: 24,658,628	M343T	probably benign	Het
Dyrk2	A	G	10: 118,860,627	V242A	probably benign	Het
Extl3	T	C	14: 65,077,568	D55G	probably benign	Het
Fabp7	A	G	10: 57,785,676	K82E	possibly damaging	Het
Fat1	G	T	8: 45,040,530		probably benign	Het
Gen1	A	G	12: 11,249,164	I280T	possibly damaging	Het
Gm5117	T	C	8: 31,737,278		noncoding transcript	Het
Gucy1b2	CCGTGTTT	C	14: 62,406,179		probably null	Het
Il3ra	G	A	14: 14,349,377		probably null	Het
Myo1f	A	G	17: 33,576,667	N66D	probably damaging	Het
Nfkb1	C	T	3: 135,613,943	E264K	possibly damaging	Het
Nsf	C	T	11: 103,930,752	E26K	possibly damaging	Het
Olfr77	G	T	9: 19,920,776	R189L	probably benign	Het
Olfr77	G	C	9: 19,920,781	D191H	probably damaging	Het
Prdm10	A	G	9: 31,349,122	H624R	possibly damaging	Het
Rgs5	G	T	1: 169,676,882	V34F	possibly damaging	Het
Sec14l4	T	C	11: 4,040,048	S116P	probably benign	Het
Sept1	T	C	7: 127,215,971		probably null	Het
Sept9	T	A	11: 117,360,461	I535N	probably damaging	Het
Sh2b1	C	T	7: 126,471,479	G350D	probably damaging	Het
Slc6a21	T	C	7: 45,280,326	V107A	probably benign	Het
Trim26	C	A	17: 36,851,003	H105N	probably damaging	Het
Trim71	A	T	9: 114,513,713	D500E	possibly damaging	Het
Vmn2r78	T	A	7: 86,920,745		probably benign	Het

Other mutations in Vmn2r84

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01461:Vmn2r84	APN	10	130391225	missense	possibly damaging	0.65
IGL01590:Vmn2r84	APN	10	130386095	missense	probably damaging	1.00
IGL01639:Vmn2r84	APN	10	130389272	nonsense	probably null
IGL01843:Vmn2r84	APN	10	130386279	missense	probably benign
IGL01911:Vmn2r84	APN	10	130386408	missense	probably damaging	0.99
IGL01937:Vmn2r84	APN	10	130385886	missense	probably damaging	1.00
IGL01977:Vmn2r84	APN	10	130394066	missense	probably benign	0.11
IGL02177:Vmn2r84	APN	10	130392012	missense	probably benign	0.00
IGL02291:Vmn2r84	APN	10	130390748	missense	probably damaging	1.00
IGL02590:Vmn2r84	APN	10	130391487	splice site	probably benign
IGL02727:Vmn2r84	APN	10	130394126	missense	possibly damaging	0.95
IGL02900:Vmn2r84	APN	10	130387992	splice site	probably benign
IGL03383:Vmn2r84	APN	10	130386687	missense	probably damaging	1.00
PIT4378001:Vmn2r84	UTSW	10	130385915	missense	probably damaging	1.00
R0076:Vmn2r84	UTSW	10	130394193	missense	probably damaging	1.00
R0089:Vmn2r84	UTSW	10	130386719	splice site	probably benign
R0153:Vmn2r84	UTSW	10	130392008	missense	probably benign	0.06
R0611:Vmn2r84	UTSW	10	130386122	missense	probably damaging	1.00
R0883:Vmn2r84	UTSW	10	130391115	missense	probably damaging	0.99
R1237:Vmn2r84	UTSW	10	130387856	splice site	probably null
R1295:Vmn2r84	UTSW	10	130389139	missense	probably benign	0.12
R1401:Vmn2r84	UTSW	10	130391990	missense	possibly damaging	0.89
R1521:Vmn2r84	UTSW	10	130389268	missense	probably benign	0.10
R1590:Vmn2r84	UTSW	10	130391480	critical splice acceptor site	probably null
R1710:Vmn2r84	UTSW	10	130391099	missense	probably benign	0.02
R1891:Vmn2r84	UTSW	10	130386069	missense	possibly damaging	0.78
R1956:Vmn2r84	UTSW	10	130390808	missense	probably benign	0.01
R1957:Vmn2r84	UTSW	10	130390808	missense	probably benign	0.01
R1962:Vmn2r84	UTSW	10	130390722	missense	probably damaging	0.99
R1994:Vmn2r84	UTSW	10	130386009	missense	probably damaging	1.00
R2124:Vmn2r84	UTSW	10	130391231	missense	probably damaging	0.99
R2474:Vmn2r84	UTSW	10	130386523	missense	possibly damaging	0.50
R2851:Vmn2r84	UTSW	10	130394167	missense	probably benign	0.05
R3508:Vmn2r84	UTSW	10	130390908	missense	probably damaging	1.00
R3792:Vmn2r84	UTSW	10	130385800	makesense	probably null
R4051:Vmn2r84	UTSW	10	130390898	missense	probably damaging	1.00
R4061:Vmn2r84	UTSW	10	130386029	missense	probably damaging	1.00
R4091:Vmn2r84	UTSW	10	130391369	missense	probably damaging	1.00
R4190:Vmn2r84	UTSW	10	130391294	nonsense	probably null
R4520:Vmn2r84	UTSW	10	130386522	missense	probably damaging	1.00
R4584:Vmn2r84	UTSW	10	130390713	missense	probably benign	0.00
R4588:Vmn2r84	UTSW	10	130385940	missense	probably damaging	0.98
R4655:Vmn2r84	UTSW	10	130394104	nonsense	probably null
R4860:Vmn2r84	UTSW	10	130385843	missense	probably damaging	0.99
R4860:Vmn2r84	UTSW	10	130385843	missense	probably damaging	0.99
R5022:Vmn2r84	UTSW	10	130386548	missense	probably damaging	1.00
R5146:Vmn2r84	UTSW	10	130386102	missense	probably damaging	1.00
R5237:Vmn2r84	UTSW	10	130385994	missense	probably damaging	0.99
R5695:Vmn2r84	UTSW	10	130389195	missense	probably benign	0.12
R5793:Vmn2r84	UTSW	10	130385885	missense	probably damaging	0.99
R6210:Vmn2r84	UTSW	10	130386245	missense	probably damaging	1.00
R6286:Vmn2r84	UTSW	10	130390868	missense	possibly damaging	0.65
R6580:Vmn2r84	UTSW	10	130389241	missense	possibly damaging	0.93
R6607:Vmn2r84	UTSW	10	130390862	missense	possibly damaging	0.87
R6818:Vmn2r84	UTSW	10	130386278	missense	probably benign	0.09
R6956:Vmn2r84	UTSW	10	130389267	missense	probably damaging	0.98
R6994:Vmn2r84	UTSW	10	130391007	missense	possibly damaging	0.90
R7075:Vmn2r84	UTSW	10	130391072	missense	probably damaging	0.99
R7225:Vmn2r84	UTSW	10	130386683	missense	probably damaging	0.99
R7252:Vmn2r84	UTSW	10	130386410	missense	probably damaging	1.00
R7263:Vmn2r84	UTSW	10	130389208	missense	probably damaging	1.00
R7297:Vmn2r84	UTSW	10	130391250	missense	probably benign	0.19
R7439:Vmn2r84	UTSW	10	130392113	missense	possibly damaging	0.90
R7441:Vmn2r84	UTSW	10	130392113	missense	possibly damaging	0.90
R7857:Vmn2r84	UTSW	10	130390869	missense	probably benign	0.00
R8263:Vmn2r84	UTSW	10	130391168	missense	probably damaging	1.00
R8555:Vmn2r84	UTSW	10	130394231	missense	probably benign	0.28
R8766:Vmn2r84	UTSW	10	130386372	missense	probably damaging	0.98
Z1177:Vmn2r84	UTSW	10	130391902	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGTCCAAGAATCAATTGCCAG -3'
(R):5'- TCTAGTTCAAGGATGGCATTGAG -3'

Sequencing Primer
(F):5'- CCAAGAATCAATTGCCAGTTTTAAGG -3'
(R):5'- AGACAGAAATTTAGCATGTCTCATAC -3'

Posted On

2014-11-11