Incidental Mutation 'R2409:Sec14l4'
ID248138
Institutional Source Beutler Lab
Gene Symbol Sec14l4
Ensembl Gene ENSMUSG00000019368
Gene NameSEC14-like lipid binding 4
Synonyms
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4031462-4048024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4040048 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 116 (S116P)
Ref Sequence ENSEMBL: ENSMUSP00000019512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019512]
Predicted Effect probably benign
Transcript: ENSMUST00000019512
AA Change: S116P

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000019512
Gene: ENSMUSG00000019368
AA Change: S116P

DomainStartEndE-ValueType
CRAL_TRIO_N 34 59 1.89e-6 SMART
SEC14 76 246 7.7e-57 SMART
Blast:SEC14 257 338 2e-36 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137324
Meta Mutation Damage Score 0.1913 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the protein encoded by the Saccharomyces cerevisiae SEC14 gene. The SEC14 protein is a phophatidylinositol transfer protein that is essential for biogenesis of Golgi-derived transport vesicles, and thus is required for the export of yeast secretory proteins from the Golgi complex. The specific function of this protein has not yet been determined. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Sec14l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02581:Sec14l4 APN 11 4039941 missense possibly damaging 0.49
R0308:Sec14l4 UTSW 11 4041726 splice site probably benign
R0538:Sec14l4 UTSW 11 4040018 missense probably benign
R2327:Sec14l4 UTSW 11 4040041 missense probably benign 0.01
R2473:Sec14l4 UTSW 11 4043359 missense probably benign 0.28
R4581:Sec14l4 UTSW 11 4043375 splice site probably null
R4684:Sec14l4 UTSW 11 4035200 critical splice donor site probably null
R5530:Sec14l4 UTSW 11 4046342 makesense probably null
R5977:Sec14l4 UTSW 11 4040055 missense possibly damaging 0.89
R6057:Sec14l4 UTSW 11 4035142 missense possibly damaging 0.95
R7664:Sec14l4 UTSW 11 4044178 nonsense probably null
R8465:Sec14l4 UTSW 11 4043948 missense probably damaging 1.00
X0026:Sec14l4 UTSW 11 4040100 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCAGCAGAACCTGGACCAG -3'
(R):5'- AGAGACAAGGTGCTGATCTTTG -3'

Sequencing Primer
(F):5'- AGGTGAGCCCCTTGCAGTATC -3'
(R):5'- GTGGTACCTAGTATCCCATTTGG -3'
Posted On2014-11-11