Incidental Mutation 'R2409:Sept9'
ID248140
Institutional Source Beutler Lab
Gene Symbol Sept9
Ensembl Gene ENSMUSG00000059248
Gene Nameseptin 9
SynonymsPNUTL4, Msf, Sint1, SL3-3 integration site 1, MSF1
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location117199661-117362325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117360461 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 535 (I535N)
Ref Sequence ENSEMBL: ENSMUSP00000101961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019038] [ENSMUST00000093907] [ENSMUST00000100193] [ENSMUST00000106349] [ENSMUST00000106354] [ENSMUST00000127383]
Predicted Effect probably damaging
Transcript: ENSMUST00000019038
AA Change: I546N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019038
Gene: ENSMUSG00000059248
AA Change: I546N

DomainStartEndE-ValueType
Pfam:DUF258 265 379 5.3e-8 PFAM
Pfam:Septin 286 565 1.2e-112 PFAM
Pfam:GTP_EFTU 289 365 1.5e-5 PFAM
Pfam:AIG1 290 379 3.1e-7 PFAM
Pfam:MMR_HSR1 291 481 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093907
AA Change: I553N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091435
Gene: ENSMUSG00000059248
AA Change: I553N

DomainStartEndE-ValueType
Pfam:Septin 293 572 1.6e-112 PFAM
Pfam:MMR_HSR1 298 444 3e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100193
AA Change: I304N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097767
Gene: ENSMUSG00000059248
AA Change: I304N

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106349
AA Change: I304N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101956
Gene: ENSMUSG00000059248
AA Change: I304N

DomainStartEndE-ValueType
Pfam:DUF258 23 138 1.1e-8 PFAM
Pfam:Septin 44 323 3.4e-113 PFAM
Pfam:GTP_EFTU 47 123 6.2e-6 PFAM
Pfam:AIG1 48 138 2.4e-7 PFAM
Pfam:MMR_HSR1 49 194 4.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106354
AA Change: I535N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101961
Gene: ENSMUSG00000059248
AA Change: I535N

DomainStartEndE-ValueType
Pfam:DUF258 254 368 4.2e-8 PFAM
Pfam:Septin 275 554 3.4e-113 PFAM
Pfam:GTP_EFTU 278 354 3.7e-6 PFAM
Pfam:AIG1 279 368 1.9e-7 PFAM
Pfam:MMR_HSR1 280 378 7.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127383
SMART Domains Protein: ENSMUSP00000120065
Gene: ENSMUSG00000059248

DomainStartEndE-ValueType
Pfam:DUF258 43 158 1.2e-8 PFAM
Pfam:Septin 63 242 6.2e-79 PFAM
Pfam:GTP_EFTU 66 142 9.2e-7 PFAM
Pfam:AIG1 67 161 4.2e-8 PFAM
Pfam:MMR_HSR1 68 222 8.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155331
Meta Mutation Damage Score 0.7600 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality around E10 with generalized apoptotic degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim26 C A 17: 36,851,003 H105N probably damaging Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Sept9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Sept9 APN 11 117352184 missense probably damaging 1.00
IGL00230:Sept9 APN 11 117354804 unclassified probably benign
IGL01520:Sept9 APN 11 117352643 missense probably damaging 1.00
IGL01905:Sept9 APN 11 117218889 missense probably benign 0.07
IGL02502:Sept9 APN 11 117290662 missense probably damaging 1.00
R0325:Sept9 UTSW 11 117356632 missense probably damaging 0.99
R0825:Sept9 UTSW 11 117359460 missense probably damaging 1.00
R0845:Sept9 UTSW 11 117356325 unclassified probably benign
R1581:Sept9 UTSW 11 117290595 missense probably damaging 1.00
R1763:Sept9 UTSW 11 117290428 missense probably benign 0.04
R1848:Sept9 UTSW 11 117353083 unclassified probably benign
R2039:Sept9 UTSW 11 117351617 missense probably damaging 1.00
R2763:Sept9 UTSW 11 117326501 missense probably benign 0.05
R3545:Sept9 UTSW 11 117352673 missense probably damaging 1.00
R4062:Sept9 UTSW 11 117352265 missense probably damaging 1.00
R4601:Sept9 UTSW 11 117360484 missense probably damaging 1.00
R5139:Sept9 UTSW 11 117356685 missense possibly damaging 0.80
R5759:Sept9 UTSW 11 117352268 missense probably benign 0.15
R6062:Sept9 UTSW 11 117290800 missense possibly damaging 0.89
R6134:Sept9 UTSW 11 117352161 missense probably damaging 1.00
R6509:Sept9 UTSW 11 117290427 missense probably benign
R7562:Sept9 UTSW 11 117326511 critical splice donor site probably null
R7573:Sept9 UTSW 11 117199745 start gained probably benign
R7592:Sept9 UTSW 11 117290662 missense probably damaging 1.00
R7810:Sept9 UTSW 11 117359438 nonsense probably null
R8200:Sept9 UTSW 11 117232716 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAACGCCACCTGGTTTTG -3'
(R):5'- CTTGTTACCTGGCAAAGTGTGG -3'

Sequencing Primer
(F):5'- CCACCTGGTTTTGCTGGG -3'
(R):5'- TTACCTGGCAAAGTGTGGGAAGAG -3'
Posted On2014-11-11