Incidental Mutation 'R2409:Trim26'
ID248146
Institutional Source Beutler Lab
Gene Symbol Trim26
Ensembl Gene ENSMUSG00000024457
Gene Nametripartite motif-containing 26
SynonymsZfp173
MMRRC Submission 040375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R2409 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36837134-36859398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 36851003 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 105 (H105N)
Ref Sequence ENSEMBL: ENSMUSP00000136651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053434] [ENSMUST00000123715] [ENSMUST00000124136] [ENSMUST00000130367] [ENSMUST00000130801] [ENSMUST00000144182] [ENSMUST00000179968]
Predicted Effect probably damaging
Transcript: ENSMUST00000053434
AA Change: H105N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060103
Gene: ENSMUSG00000024457
AA Change: H105N

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
PRY 318 370 6.18e-19 SMART
SPRY 371 545 3.03e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000123715
AA Change: H105N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118438
Gene: ENSMUSG00000024457
AA Change: H105N

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124136
SMART Domains Protein: ENSMUSP00000120764
Gene: ENSMUSG00000024457

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
PRY 121 173 6.18e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130367
AA Change: H105N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114896
Gene: ENSMUSG00000024457
AA Change: H105N

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
PRY 318 370 6.18e-19 SMART
SPRY 371 545 3.03e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130801
AA Change: H105N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118388
Gene: ENSMUSG00000024457
AA Change: H105N

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134325
Predicted Effect probably damaging
Transcript: ENSMUST00000144182
AA Change: H105N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114565
Gene: ENSMUSG00000024457
AA Change: H105N

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
PRY 318 370 6.18e-19 SMART
low complexity region 379 394 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156872
Predicted Effect probably damaging
Transcript: ENSMUST00000179968
AA Change: H105N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136651
Gene: ENSMUSG00000024457
AA Change: H105N

DomainStartEndE-ValueType
RING 16 56 2.27e-8 SMART
BBOX 97 138 4.33e-14 SMART
low complexity region 206 219 N/A INTRINSIC
PRY 318 370 6.18e-19 SMART
SPRY 371 545 3.03e-28 SMART
Meta Mutation Damage Score 0.8887 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 100% (32/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein localizes to cytoplasmic bodies. Although the function of the protein is unknown, the RING domain suggests that the protein may have DNA-binding activity. The gene localizes to the major histocompatibility complex (MHC) class I region on chromosome 6. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a C T 5: 8,738,747 T1042I probably benign Het
Adamts13 A G 2: 26,978,362 T162A probably benign Het
Adamts7 T A 9: 90,180,687 I398N probably damaging Het
Cib2 A G 9: 54,545,467 probably null Het
Cyp3a16 T C 5: 145,440,367 K470R probably benign Het
Dpy19l2 A G 9: 24,658,628 M343T probably benign Het
Dyrk2 A G 10: 118,860,627 V242A probably benign Het
Extl3 T C 14: 65,077,568 D55G probably benign Het
Fabp7 A G 10: 57,785,676 K82E possibly damaging Het
Fat1 G T 8: 45,040,530 probably benign Het
Gen1 A G 12: 11,249,164 I280T possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gucy1b2 CCGTGTTT C 14: 62,406,179 probably null Het
Il3ra G A 14: 14,349,377 probably null Het
Myo1f A G 17: 33,576,667 N66D probably damaging Het
Nfkb1 C T 3: 135,613,943 E264K possibly damaging Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr77 G T 9: 19,920,776 R189L probably benign Het
Olfr77 G C 9: 19,920,781 D191H probably damaging Het
Prdm10 A G 9: 31,349,122 H624R possibly damaging Het
Rgs5 G T 1: 169,676,882 V34F possibly damaging Het
Sec14l4 T C 11: 4,040,048 S116P probably benign Het
Sept1 T C 7: 127,215,971 probably null Het
Sept9 T A 11: 117,360,461 I535N probably damaging Het
Sh2b1 C T 7: 126,471,479 G350D probably damaging Het
Slc6a21 T C 7: 45,280,326 V107A probably benign Het
Trim71 A T 9: 114,513,713 D500E possibly damaging Het
Vmn2r78 T A 7: 86,920,745 probably benign Het
Vmn2r84 A G 10: 130,392,071 S99P probably damaging Het
Other mutations in Trim26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02622:Trim26 APN 17 36850905 missense probably damaging 1.00
R0047:Trim26 UTSW 17 36857864 unclassified probably benign
R0483:Trim26 UTSW 17 36852706 splice site probably benign
R0732:Trim26 UTSW 17 36852618 missense possibly damaging 0.54
R2384:Trim26 UTSW 17 36850889 missense probably damaging 1.00
R4864:Trim26 UTSW 17 36857994 unclassified probably benign
R5121:Trim26 UTSW 17 36851066 nonsense probably null
R5463:Trim26 UTSW 17 36851124 missense probably damaging 1.00
R6259:Trim26 UTSW 17 36856218 missense probably benign 0.07
R7863:Trim26 UTSW 17 36850772 missense probably damaging 1.00
R8090:Trim26 UTSW 17 36856748 missense possibly damaging 0.60
R8344:Trim26 UTSW 17 36857710 missense unknown
R8405:Trim26 UTSW 17 36856203 missense possibly damaging 0.48
Z1177:Trim26 UTSW 17 36857572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCACAAGTGATATCCGC -3'
(R):5'- GAGATGAGTGTCCTGAGCTG -3'

Sequencing Primer
(F):5'- AGTGATATCCGCCCCATATCGG -3'
(R):5'- TGTCCTGAGCTGGGGCAG -3'
Posted On2014-11-11