Incidental Mutation 'R2372:Alpi'
ID248149
Institutional Source Beutler Lab
Gene Symbol Alpi
Ensembl Gene ENSMUSG00000079440
Gene Namealkaline phosphatase, intestinal
Synonyms2010001C14Rik
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87098002-87101606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 87100594 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 169 (T169N)
Ref Sequence ENSEMBL: ENSMUSP00000108895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113270]
Predicted Effect probably damaging
Transcript: ENSMUST00000113270
AA Change: T169N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108895
Gene: ENSMUSG00000079440
AA Change: T169N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
alkPPc 54 489 7.97e-247 SMART
low complexity region 509 532 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186823
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an alkaline phosphatase, a metalloenzyme that catalyzes the hydrolysis of phosphoric acid monoesters. It belongs to a multigene family composed of four alkaline phosphatase isoenzymes. The enzyme functions as a homodimer and has a catalytic site containing one magnesium and two zinc ions, which are required for its enzymatic function. The protein is primarily expressed in placental and endometrial tissue; however, strong ectopic expression has been detected in ovarian adenocarcinoma, serous cystadenocarcinoma, and other ovarian cancer cells. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Alpi
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Alpi APN 1 87099720 missense probably damaging 1.00
IGL01972:Alpi APN 1 87099709 missense probably damaging 1.00
IGL02672:Alpi APN 1 87101272 missense probably damaging 1.00
IGL03089:Alpi APN 1 87100108 missense probably benign 0.05
IGL03099:Alpi APN 1 87098631 missense unknown
IGL03154:Alpi APN 1 87100088 missense probably damaging 1.00
IGL03372:Alpi APN 1 87100628 splice site probably benign
K7371:Alpi UTSW 1 87099171 splice site probably benign
R0053:Alpi UTSW 1 87098790 missense probably benign 0.03
R0054:Alpi UTSW 1 87099765 missense possibly damaging 0.61
R0070:Alpi UTSW 1 87101159 splice site probably benign
R1586:Alpi UTSW 1 87100201 missense probably damaging 1.00
R1835:Alpi UTSW 1 87099414 missense possibly damaging 0.88
R4546:Alpi UTSW 1 87099117 missense probably damaging 1.00
R4861:Alpi UTSW 1 87100469 missense probably damaging 0.98
R4861:Alpi UTSW 1 87100469 missense probably damaging 0.98
R4968:Alpi UTSW 1 87101525 missense probably benign 0.05
R5427:Alpi UTSW 1 87101354 missense probably benign 0.04
R6245:Alpi UTSW 1 87100834 missense probably damaging 1.00
R6394:Alpi UTSW 1 87100706 missense possibly damaging 0.71
R6398:Alpi UTSW 1 87099462 missense probably damaging 0.98
R6616:Alpi UTSW 1 87101114 missense possibly damaging 0.81
R7168:Alpi UTSW 1 87099433 missense possibly damaging 0.94
R7448:Alpi UTSW 1 87101535 start codon destroyed possibly damaging 0.79
R7473:Alpi UTSW 1 87099647 critical splice donor site probably null
R7527:Alpi UTSW 1 87098955 missense probably benign 0.01
R7552:Alpi UTSW 1 87099073 missense probably benign 0.00
R8008:Alpi UTSW 1 87098662 missense unknown
X0052:Alpi UTSW 1 87100201 missense probably damaging 1.00
X0057:Alpi UTSW 1 87101078 missense probably damaging 1.00
Z1176:Alpi UTSW 1 87099072 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAGGCTGTTTATGCCTGGAAC -3'
(R):5'- AGTGCAGCTGCTCGATTAG -3'

Sequencing Primer
(F):5'- TATGCCTGGAACTATGGCCAGTC -3'
(R):5'- AGCTGCTCGATTAGACCAGTG -3'
Posted On2014-11-11