Incidental Mutation 'R2372:Trove2'
ID248151
Institutional Source Beutler Lab
Gene Symbol Trove2
Ensembl Gene ENSMUSG00000018199
Gene NameTROVE domain family, member 2
Synonyms1810007I17Rik, A530054J02Rik, SS-A/Ro, Ssa, Ssa2
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location143750790-143777068 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 143770882 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 42 (E42*)
Ref Sequence ENSEMBL: ENSMUSP00000125623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159879]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000018343
Predicted Effect probably null
Transcript: ENSMUST00000159879
AA Change: E42*
SMART Domains Protein: ENSMUSP00000125623
Gene: ENSMUSG00000018199
AA Change: E42*

DomainStartEndE-ValueType
Pfam:TROVE 16 369 9.7e-99 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Homozygous mutant mice develop symptoms similar to those observed in patients with lupus, including increased photosensitivity and membranoproliferative glomerulonephritis. The production of autoantibodies is detected in both homozygous and heterozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Trove2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Trove2 APN 1 143761382 missense probably benign 0.29
IGL01578:Trove2 APN 1 143761300 missense probably damaging 0.99
IGL02006:Trove2 APN 1 143760346 splice site probably benign
IGL02155:Trove2 APN 1 143761269 critical splice donor site probably null
IGL02219:Trove2 APN 1 143761275 missense possibly damaging 0.94
IGL02637:Trove2 APN 1 143770788 missense probably damaging 1.00
IGL03013:Trove2 APN 1 143770708 missense probably damaging 1.00
IGL03075:Trove2 APN 1 143770771 missense probably benign
R0415:Trove2 UTSW 1 143760075 missense probably benign 0.00
R0443:Trove2 UTSW 1 143765923 splice site probably benign
R0479:Trove2 UTSW 1 143757751 missense possibly damaging 0.72
R1696:Trove2 UTSW 1 143757837 missense probably damaging 0.99
R1728:Trove2 UTSW 1 143760014 missense probably benign
R1728:Trove2 UTSW 1 143760034 missense probably benign
R1729:Trove2 UTSW 1 143760014 missense probably benign
R1729:Trove2 UTSW 1 143760034 missense probably benign
R1730:Trove2 UTSW 1 143760014 missense probably benign
R1730:Trove2 UTSW 1 143760034 missense probably benign
R1739:Trove2 UTSW 1 143760014 missense probably benign
R1739:Trove2 UTSW 1 143760034 missense probably benign
R1762:Trove2 UTSW 1 143760014 missense probably benign
R1762:Trove2 UTSW 1 143760034 missense probably benign
R1783:Trove2 UTSW 1 143760014 missense probably benign
R1783:Trove2 UTSW 1 143760034 missense probably benign
R1784:Trove2 UTSW 1 143760014 missense probably benign
R1784:Trove2 UTSW 1 143760034 missense probably benign
R1785:Trove2 UTSW 1 143760014 missense probably benign
R1785:Trove2 UTSW 1 143760034 missense probably benign
R1857:Trove2 UTSW 1 143770750 missense probably benign 0.00
R2049:Trove2 UTSW 1 143760034 missense probably benign
R2130:Trove2 UTSW 1 143760034 missense probably benign
R2131:Trove2 UTSW 1 143760034 missense probably benign
R2133:Trove2 UTSW 1 143760034 missense probably benign
R2141:Trove2 UTSW 1 143760034 missense probably benign
R2142:Trove2 UTSW 1 143760034 missense probably benign
R2929:Trove2 UTSW 1 143757878 missense possibly damaging 0.92
R4191:Trove2 UTSW 1 143770786 missense probably benign 0.00
R5520:Trove2 UTSW 1 143770771 missense probably benign
R5821:Trove2 UTSW 1 143766765 missense probably benign 0.09
R7432:Trove2 UTSW 1 143765810 missense probably benign 0.43
R7658:Trove2 UTSW 1 143770873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACAGCTTTAAAGGCTGCTTG -3'
(R):5'- TGGTTCTGCCTTCACTTAATTGTAG -3'

Sequencing Primer
(F):5'- GTTTATGTCCGCACACTGGGAAC -3'
(R):5'- GAAGGATCTGCAAACCAG -3'
Posted On2014-11-11