Incidental Mutation 'R2372:Kif12'
ID248154
Institutional Source Beutler Lab
Gene Symbol Kif12
Ensembl Gene ENSMUSG00000028357
Gene Namekinesin family member 12
SynonymsN-9 kinesin
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location63165630-63172131 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63168559 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 347 (T347S)
Ref Sequence ENSEMBL: ENSMUSP00000030042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030042] [ENSMUST00000124739] [ENSMUST00000156618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030042
AA Change: T347S

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000030042
Gene: ENSMUSG00000028357
AA Change: T347S

DomainStartEndE-ValueType
KISc 23 368 4.46e-108 SMART
coiled coil region 376 464 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124739
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131760
Predicted Effect probably benign
Transcript: ENSMUST00000154234
Predicted Effect possibly damaging
Transcript: ENSMUST00000156618
AA Change: T347S

PolyPhen 2 Score 0.583 (Sensitivity: 0.88; Specificity: 0.91)
Meta Mutation Damage Score 0.2683 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily of microtubule-associated molecular motors with functions related to the microtubule cytosekelton. Members of this superfamily play important roles in intracellular transport and cell division. A similar protein in mouse functions in the beta cell antioxidant signaling cascade, acting as a scaffold for the transcription factor specificity protein 1 (Sp1). Mice that lack this gene exhibit beta cell oxidative stress resulting in hypoinsulinemic glucose intolerance. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Kif12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Kif12 APN 4 63165884 missense probably damaging 0.99
IGL01377:Kif12 APN 4 63170725 missense probably damaging 1.00
IGL02232:Kif12 APN 4 63166495 missense probably benign 0.00
IGL02671:Kif12 APN 4 63170457 missense probably benign 0.05
IGL02719:Kif12 APN 4 63167796 missense probably benign
IGL03056:Kif12 APN 4 63166956 missense probably null 0.00
ANU05:Kif12 UTSW 4 63171423 small insertion probably benign
ANU23:Kif12 UTSW 4 63165884 missense probably damaging 0.99
ANU74:Kif12 UTSW 4 63171423 small insertion probably benign
ANU74:Kif12 UTSW 4 63171426 frame shift probably null
IGL02984:Kif12 UTSW 4 63171423 small insertion probably benign
R0401:Kif12 UTSW 4 63169525 splice site probably benign
R0927:Kif12 UTSW 4 63168773 missense possibly damaging 0.71
R1589:Kif12 UTSW 4 63166500 missense probably benign 0.00
R2178:Kif12 UTSW 4 63166959 missense probably benign 0.00
R2263:Kif12 UTSW 4 63169521 missense probably benign 0.00
R2404:Kif12 UTSW 4 63170553 missense probably damaging 1.00
R3903:Kif12 UTSW 4 63167976 missense possibly damaging 0.73
R4126:Kif12 UTSW 4 63166437 missense probably benign 0.00
R4271:Kif12 UTSW 4 63170746 missense probably benign 0.39
R4386:Kif12 UTSW 4 63171218 missense probably damaging 1.00
R4750:Kif12 UTSW 4 63167783 missense probably damaging 0.99
R4945:Kif12 UTSW 4 63168493 critical splice donor site probably null
R5177:Kif12 UTSW 4 63167904 missense probably benign 0.13
R5421:Kif12 UTSW 4 63171428 missense probably benign 0.40
R5644:Kif12 UTSW 4 63165893 missense possibly damaging 0.75
R5757:Kif12 UTSW 4 63170518 missense probably damaging 1.00
R5772:Kif12 UTSW 4 63165941 missense probably damaging 1.00
R5858:Kif12 UTSW 4 63166410 missense probably benign 0.04
R5929:Kif12 UTSW 4 63168517 missense probably damaging 0.96
R6648:Kif12 UTSW 4 63171317 critical splice donor site probably null
R7007:Kif12 UTSW 4 63166480 missense probably benign
R7108:Kif12 UTSW 4 63171205 missense probably benign 0.15
R7171:Kif12 UTSW 4 63168694 missense probably damaging 1.00
R7852:Kif12 UTSW 4 63167989 missense probably benign 0.13
R8532:Kif12 UTSW 4 63169419 nonsense probably null
RF011:Kif12 UTSW 4 63171427 small insertion probably benign
RF031:Kif12 UTSW 4 63171425 small insertion probably benign
RF036:Kif12 UTSW 4 63171427 small insertion probably benign
RF039:Kif12 UTSW 4 63171425 small insertion probably benign
RF041:Kif12 UTSW 4 63171425 small insertion probably benign
T0975:Kif12 UTSW 4 63171423 small insertion probably benign
Z1088:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171423 small insertion probably benign
Z1176:Kif12 UTSW 4 63171997 missense possibly damaging 0.95
Z1177:Kif12 UTSW 4 63171423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GCCCAGACTCTGTGACATAGAC -3'
(R):5'- ACAGCAAGCTCACCAAGTTG -3'

Sequencing Primer
(F):5'- GTGACATAGACCCTTGGCTATGAC -3'
(R):5'- CAAGTTGCTGGCAGACTCACTTG -3'
Posted On2014-11-11