Incidental Mutation 'R2372:Skint1'
ID248156
Institutional Source Beutler Lab
Gene Symbol Skint1
Ensembl Gene ENSMUSG00000089773
Gene Nameselection and upkeep of intraepithelial T cells 1
Synonyms
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location112006269-112029538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112019151 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 90 (Y90N)
Ref Sequence ENSEMBL: ENSMUSP00000125625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117379] [ENSMUST00000161389] [ENSMUST00000162158] [ENSMUST00000162885]
Predicted Effect probably damaging
Transcript: ENSMUST00000117379
AA Change: Y90N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124545
Gene: ENSMUSG00000089773
AA Change: Y90N

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Pfam:C2-set_2 142 228 2.5e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161389
AA Change: Y90N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125313
Gene: ENSMUSG00000089773
AA Change: Y90N

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Pfam:C2-set_2 142 228 3.1e-6 PFAM
transmembrane domain 248 267 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162158
AA Change: Y90N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124737
Gene: ENSMUSG00000089773
AA Change: Y90N

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IGv 44 125 1.88e-8 SMART
transmembrane domain 247 269 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162885
AA Change: Y90N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125625
Gene: ENSMUSG00000089773
AA Change: Y90N

DomainStartEndE-ValueType
IGv 44 125 1.88e-8 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a point mutation allele exhibit impaired T cell differentiation with reduced Vgamma5+Vdelta1+ T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Skint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Skint1 APN 4 112021580 critical splice donor site probably null
IGL01890:Skint1 APN 4 112010681 missense probably damaging 1.00
IGL02020:Skint1 APN 4 112025527 missense probably benign 0.08
IGL02045:Skint1 APN 4 112025530 missense possibly damaging 0.80
R0421:Skint1 UTSW 4 112019014 missense possibly damaging 0.74
R0544:Skint1 UTSW 4 112021365 missense probably damaging 1.00
R0617:Skint1 UTSW 4 112029399 splice site probably benign
R0881:Skint1 UTSW 4 112028857 missense probably benign 0.04
R0973:Skint1 UTSW 4 112028215 splice site probably benign
R1036:Skint1 UTSW 4 112019296 missense possibly damaging 0.71
R1469:Skint1 UTSW 4 112025511 missense probably benign 0.00
R1469:Skint1 UTSW 4 112025511 missense probably benign 0.00
R2029:Skint1 UTSW 4 112021456 unclassified probably null
R2063:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2064:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2065:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2066:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2067:Skint1 UTSW 4 112025533 missense probably benign 0.00
R2518:Skint1 UTSW 4 112025481 missense probably benign 0.25
R2971:Skint1 UTSW 4 112021330 missense possibly damaging 0.50
R4656:Skint1 UTSW 4 112021477 missense probably damaging 1.00
R4993:Skint1 UTSW 4 112028333 critical splice donor site probably null
R5083:Skint1 UTSW 4 112029433 missense probably benign 0.01
R5450:Skint1 UTSW 4 112025532 missense probably benign 0.00
R5583:Skint1 UTSW 4 112019056 missense probably damaging 1.00
R5645:Skint1 UTSW 4 112025502 missense probably benign 0.41
R5877:Skint1 UTSW 4 112021523 nonsense probably null
R5950:Skint1 UTSW 4 112019335 missense probably benign
R5974:Skint1 UTSW 4 112019319 missense probably benign 0.02
R6216:Skint1 UTSW 4 112021482 missense probably benign 0.00
R6494:Skint1 UTSW 4 112010712 missense probably benign 0.06
R7348:Skint1 UTSW 4 112021573 missense probably damaging 1.00
R7752:Skint1 UTSW 4 112019202 missense probably damaging 1.00
R7901:Skint1 UTSW 4 112019202 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCCATTTATAGTGAACGGC -3'
(R):5'- ATCTATCTTTCAGACCCAGAAGAG -3'

Sequencing Primer
(F):5'- GCCATTTATAGTGAACGGCTTAGAG -3'
(R):5'- GTTGATTCATAGAAACCTCGGAAAG -3'
Posted On2014-11-11