Incidental Mutation 'R2372:Hpca'
ID248157
Institutional Source Beutler Lab
Gene Symbol Hpca
Ensembl Gene ENSMUSG00000028785
Gene Namehippocalcin
Synonyms
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129111570-129122036 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 129118444 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 100 (K100*)
Ref Sequence ENSEMBL: ENSMUSP00000129548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030572] [ENSMUST00000095807] [ENSMUST00000116442] [ENSMUST00000116444] [ENSMUST00000125931] [ENSMUST00000135763] [ENSMUST00000139450] [ENSMUST00000149763] [ENSMUST00000164649]
Predicted Effect probably null
Transcript: ENSMUST00000030572
AA Change: K100*
SMART Domains Protein: ENSMUSP00000030572
Gene: ENSMUSG00000028785
AA Change: K100*

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095807
AA Change: K100*
SMART Domains Protein: ENSMUSP00000093486
Gene: ENSMUSG00000028785
AA Change: K100*

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000116442
AA Change: K100*
SMART Domains Protein: ENSMUSP00000112143
Gene: ENSMUSG00000028785
AA Change: K100*

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000116444
AA Change: K100*
SMART Domains Protein: ENSMUSP00000112145
Gene: ENSMUSG00000028785
AA Change: K100*

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000125931
AA Change: K100*
SMART Domains Protein: ENSMUSP00000115031
Gene: ENSMUSG00000028785
AA Change: K100*

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135763
Predicted Effect probably null
Transcript: ENSMUST00000139450
AA Change: K100*
SMART Domains Protein: ENSMUSP00000119178
Gene: ENSMUSG00000028785
AA Change: K100*

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000149763
AA Change: K100*
SMART Domains Protein: ENSMUSP00000115619
Gene: ENSMUSG00000028785
AA Change: K100*

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164649
AA Change: K100*
SMART Domains Protein: ENSMUSP00000129548
Gene: ENSMUSG00000028785
AA Change: K100*

DomainStartEndE-ValueType
EFh 64 92 2.37e-3 SMART
EFh 100 128 3.1e-7 SMART
EFh 148 176 1.29e-4 SMART
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. This protein is associated with the plasma membrane. It has similarities to proteins located in the photoreceptor cells that regulate photosignal transduction in a calcium-sensitive manner. This protein displays recoverin activity and a calcium-dependent inhibition of rhodopsin kinase. It is identical to the rat and mouse hippocalcin proteins and thought to play an important role in neurons of the central nervous system in a number of species. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit an age-dependent increase in neurodegeneration in the hippocampus and the cortex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Hpca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02523:Hpca APN 4 129118575 missense probably damaging 1.00
IGL02893:Hpca APN 4 129118422 missense probably damaging 1.00
IGL03083:Hpca APN 4 129118526 missense probably damaging 1.00
IGL03165:Hpca APN 4 129118590 missense probably damaging 1.00
R1840:Hpca UTSW 4 129118600 missense probably damaging 1.00
R2147:Hpca UTSW 4 129118485 missense possibly damaging 0.86
R6265:Hpca UTSW 4 129118652 nonsense probably null
R7237:Hpca UTSW 4 129118614 missense probably damaging 1.00
R7602:Hpca UTSW 4 129120226 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTACTCTGGACTAGATTGCATCC -3'
(R):5'- TACAAGGGCTTCCTGAAGGAC -3'

Sequencing Primer
(F):5'- CTCTGGACTAGATTGCATCCAGAGG -3'
(R):5'- CACTGGCATCCTCAACGTG -3'
Posted On2014-11-11