Mutagenetix > Incidental Mutation

Incidental Mutation 'R2372:Hpca'

248157

Institutional Source

Beutler Lab

Gene Symbol

Hpca

Ensembl Gene

ENSMUSG00000028785

Gene Name

hippocalcin

Synonyms

MMRRC Submission

040352-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

R2372 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129005363-129015829 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 129012237 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 100 (K100*)

Ref Sequence

ENSEMBL: ENSMUSP00000129548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030572] [ENSMUST00000095807] [ENSMUST00000116442] [ENSMUST00000116444] [ENSMUST00000125931] [ENSMUST00000135763] [ENSMUST00000139450] [ENSMUST00000164649] [ENSMUST00000149763]

AlphaFold

P84075

Predicted Effect

probably null
Transcript: ENSMUST00000030572
AA Change: K100*

SMART Domains

Protein: ENSMUSP00000030572
Gene: ENSMUSG00000028785
AA Change: K100*

Domain	Start	End	E-Value	Type
EFh	64	92	2.37e-3	SMART
EFh	100	128	3.1e-7	SMART
EFh	148	176	1.29e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000095807
AA Change: K100*

SMART Domains

Protein: ENSMUSP00000093486
Gene: ENSMUSG00000028785
AA Change: K100*

Domain	Start	End	E-Value	Type
EFh	64	92	2.37e-3	SMART
EFh	100	128	3.1e-7	SMART
EFh	148	176	1.29e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000116442
AA Change: K100*

SMART Domains

Protein: ENSMUSP00000112143
Gene: ENSMUSG00000028785
AA Change: K100*

Domain	Start	End	E-Value	Type
EFh	64	92	2.37e-3	SMART
EFh	100	128	3.1e-7	SMART
EFh	148	176	1.29e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000116444
AA Change: K100*

SMART Domains

Protein: ENSMUSP00000112145
Gene: ENSMUSG00000028785
AA Change: K100*

Domain	Start	End	E-Value	Type
EFh	64	92	2.37e-3	SMART
EFh	100	128	3.1e-7	SMART
EFh	148	176	1.29e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000125931
AA Change: K100*

SMART Domains

Protein: ENSMUSP00000115031
Gene: ENSMUSG00000028785
AA Change: K100*

Domain	Start	End	E-Value	Type
EFh	64	92	2.37e-3	SMART
EFh	100	128	3.1e-7	SMART
EFh	148	176	1.29e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135763

Predicted Effect

probably null
Transcript: ENSMUST00000139450
AA Change: K100*

SMART Domains

Protein: ENSMUSP00000119178
Gene: ENSMUSG00000028785
AA Change: K100*

Domain	Start	End	E-Value	Type
EFh	64	92	2.37e-3	SMART
EFh	100	128	3.1e-7	SMART
EFh	148	176	1.29e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000164649
AA Change: K100*

SMART Domains

Protein: ENSMUSP00000129548
Gene: ENSMUSG00000028785
AA Change: K100*

Domain	Start	End	E-Value	Type
EFh	64	92	2.37e-3	SMART
EFh	100	128	3.1e-7	SMART
EFh	148	176	1.29e-4	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000149763
AA Change: K100*

SMART Domains

Protein: ENSMUSP00000115619
Gene: ENSMUSG00000028785
AA Change: K100*

Domain	Start	End	E-Value	Type
EFh	64	92	2.37e-3	SMART
EFh	100	128	3.1e-7	SMART

Meta Mutation Damage Score

0.9754

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.2%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of neuron-specific calcium-binding proteins family found in the retina and brain. This protein is associated with the plasma membrane. It has similarities to proteins located in the photoreceptor cells that regulate photosignal transduction in a calcium-sensitive manner. This protein displays recoverin activity and a calcium-dependent inhibition of rhodopsin kinase. It is identical to the rat and mouse hippocalcin proteins and thought to play an important role in neurons of the central nervous system in a number of species. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit an age-dependent increase in neurodegeneration in the hippocampus and the cortex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700008O03Rik	A	G	7: 44,009,704 (GRCm39)	L135S	probably damaging	Het
A2ml1	C	T	6: 128,557,349 (GRCm39)	A115T	probably benign	Het
Alpi	G	T	1: 87,028,316 (GRCm39)	T169N	probably damaging	Het
Ccdc15	T	C	9: 37,226,801 (GRCm39)	D378G	possibly damaging	Het
Cpb2	T	G	14: 75,505,490 (GRCm39)	V162G	probably damaging	Het
Dnmbp	T	C	19: 43,890,759 (GRCm39)	E336G	probably benign	Het
Dok6	G	C	18: 89,432,988 (GRCm39)	R274G	probably null	Het
Eef1d	G	A	15: 75,768,166 (GRCm39)	R199C	probably damaging	Het
Epha8	T	C	4: 136,660,321 (GRCm39)	Y714C	probably damaging	Het
Fyb1	T	C	15: 6,681,388 (GRCm39)		probably benign	Het
Gfpt2	A	G	11: 49,698,542 (GRCm39)	N46D	probably benign	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 118,989,784 (GRCm39)		probably benign	Het
Gm11596	C	A	11: 99,684,082 (GRCm39)	E13*	probably null	Het
Gsx2	T	C	5: 75,237,713 (GRCm39)	F222L	probably damaging	Het
Iqsec1	A	G	6: 90,671,636 (GRCm39)	S89P	probably damaging	Het
Kif12	T	A	4: 63,086,796 (GRCm39)	T347S	possibly damaging	Het
Knop1	A	G	7: 118,452,440 (GRCm39)	L93S	probably damaging	Het
Mib1	A	G	18: 10,812,045 (GRCm39)	T981A	probably damaging	Het
N4bp2l1	C	T	5: 150,496,246 (GRCm39)	E123K	probably damaging	Het
Npr2	C	T	4: 43,650,432 (GRCm39)	R976W	probably damaging	Het
Rbpj	T	C	5: 53,799,537 (GRCm39)		probably benign	Het
Ro60	C	A	1: 143,646,620 (GRCm39)	E42*	probably null	Het
Ruvbl1	T	C	6: 88,462,779 (GRCm39)	V301A	possibly damaging	Het
Sgip1	T	C	4: 102,766,988 (GRCm39)		probably null	Het
Sh3bp2	T	C	5: 34,716,840 (GRCm39)	I361T	probably benign	Het
Skint1	T	A	4: 111,876,348 (GRCm39)	Y90N	probably damaging	Het
Slc25a45	G	A	19: 5,934,580 (GRCm39)	V183I	probably benign	Het
Slco4c1	T	A	1: 96,748,925 (GRCm39)	H664L	probably benign	Het
Sult2a4	T	A	7: 13,649,225 (GRCm39)	I194L	probably benign	Het
Tecta	C	A	9: 42,299,570 (GRCm39)	D173Y	probably damaging	Het
Tnrc18	T	A	5: 142,745,459 (GRCm39)		probably benign	Het
Use1	T	C	8: 71,821,823 (GRCm39)	L169P	possibly damaging	Het
Zfp335	A	G	2: 164,736,959 (GRCm39)	L918P	probably damaging	Het
Zfp451	A	T	1: 33,819,133 (GRCm39)		probably null	Het

Other mutations in Hpca

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02523:Hpca	APN	4	129,012,368 (GRCm39)	missense	probably damaging	1.00
IGL02893:Hpca	APN	4	129,012,215 (GRCm39)	missense	probably damaging	1.00
IGL03083:Hpca	APN	4	129,012,319 (GRCm39)	missense	probably damaging	1.00
IGL03165:Hpca	APN	4	129,012,383 (GRCm39)	missense	probably damaging	1.00
R1840:Hpca	UTSW	4	129,012,393 (GRCm39)	missense	probably damaging	1.00
R2147:Hpca	UTSW	4	129,012,278 (GRCm39)	missense	possibly damaging	0.86
R6265:Hpca	UTSW	4	129,012,445 (GRCm39)	nonsense	probably null
R7237:Hpca	UTSW	4	129,012,407 (GRCm39)	missense	probably damaging	1.00
R7602:Hpca	UTSW	4	129,014,019 (GRCm39)	intron	probably benign
R8956:Hpca	UTSW	4	129,012,287 (GRCm39)	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACTACTCTGGACTAGATTGCATCC -3'
(R):5'- TACAAGGGCTTCCTGAAGGAC -3'

Sequencing Primer
(F):5'- CTCTGGACTAGATTGCATCCAGAGG -3'
(R):5'- CACTGGCATCCTCAACGTG -3'

Posted On

2014-11-11