Incidental Mutation 'R2372:Epha8'
ID248158
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene NameEph receptor A8
SynonymsEphA8, Hek3, Eek
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location136929419-136956816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136933010 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 714 (Y714C)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
Predicted Effect probably damaging
Transcript: ENSMUST00000030420
AA Change: Y714C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: Y714C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Meta Mutation Damage Score 0.7241 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Sh3bp2 T C 5: 34,559,496 I361T probably benign Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5552:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R5830:Epha8 UTSW 4 136936390 nonsense probably null
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R6799:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7826:Epha8 UTSW 4 136936187 missense probably benign 0.09
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8294:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8295:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAACTCTAGGACCTTCATGG -3'
(R):5'- GTCCCTAGATGATCCTGGAGTG -3'

Sequencing Primer
(F):5'- GCAATTTGATCAACTGGACCTC -3'
(R):5'- CCTAGATGATCCTGGAGTGCTCAG -3'
Posted On2014-11-11