Incidental Mutation 'R2372:Sh3bp2'
ID248160
Institutional Source Beutler Lab
Gene Symbol Sh3bp2
Ensembl Gene ENSMUSG00000054520
Gene NameSH3-domain binding protein 2
Synonyms3BP2
MMRRC Submission 040352-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2372 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34525838-34563641 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34559496 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 361 (I361T)
Ref Sequence ENSEMBL: ENSMUSP00000136671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067638] [ENSMUST00000101316] [ENSMUST00000118545] [ENSMUST00000179943]
Predicted Effect probably benign
Transcript: ENSMUST00000067638
AA Change: I361T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070890
Gene: ENSMUSG00000054520
AA Change: I361T

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101316
AA Change: I405T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098874
Gene: ENSMUSG00000054520
AA Change: I405T

DomainStartEndE-ValueType
PH 71 176 1.33e-18 SMART
low complexity region 185 195 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 244 260 N/A INTRINSIC
low complexity region 272 285 N/A INTRINSIC
low complexity region 357 371 N/A INTRINSIC
low complexity region 414 429 N/A INTRINSIC
SH2 497 586 2.04e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118545
AA Change: I417T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112554
Gene: ENSMUSG00000054520
AA Change: I417T

DomainStartEndE-ValueType
PH 83 188 1.33e-18 SMART
low complexity region 197 207 N/A INTRINSIC
low complexity region 226 241 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 284 297 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
SH2 509 598 2.04e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153750
Predicted Effect probably benign
Transcript: ENSMUST00000179943
AA Change: I361T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136671
Gene: ENSMUSG00000054520
AA Change: I361T

DomainStartEndE-ValueType
PH 27 132 1.33e-18 SMART
low complexity region 141 151 N/A INTRINSIC
low complexity region 170 185 N/A INTRINSIC
low complexity region 200 216 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
low complexity region 313 327 N/A INTRINSIC
low complexity region 370 385 N/A INTRINSIC
SH2 453 542 2.04e-15 SMART
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has an N-terminal pleckstrin homology (PH) domain, an SH3-binding proline-rich region, and a C-terminal SH2 domain. The protein binds to the SH3 domains of several proteins including the ABL1 and SYK protein tyrosine kinases , and functions as a cytoplasmic adaptor protein to positively regulate transcriptional activity in T, natural killer (NK), and basophilic cells. Mutations in this gene result in cherubism. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Nullizygous mutations may lead to higher pre-B cell numbers and impaired B cell receptor signaling or thymus-independent type 2 humoral responses. Homozygosity for a knock-in allele causes premature death, enhanced osteoclast differentiation and TNF production, systemic bone loss and inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700008O03Rik A G 7: 44,360,280 L135S probably damaging Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Alpi G T 1: 87,100,594 T169N probably damaging Het
Ccdc15 T C 9: 37,315,505 D378G possibly damaging Het
Cpb2 T G 14: 75,268,050 V162G probably damaging Het
Dnmbp T C 19: 43,902,320 E336G probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Eef1d G A 15: 75,896,317 R199C probably damaging Het
Epha8 T C 4: 136,933,010 Y714C probably damaging Het
Fyb T C 15: 6,651,907 probably benign Het
Gfpt2 A G 11: 49,807,715 N46D probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably benign Het
Gm11596 C A 11: 99,793,256 E13* probably null Het
Gsx2 T C 5: 75,077,052 F222L probably damaging Het
Hpca T A 4: 129,118,444 K100* probably null Het
Iqsec1 A G 6: 90,694,654 S89P probably damaging Het
Kif12 T A 4: 63,168,559 T347S possibly damaging Het
Knop1 A G 7: 118,853,217 L93S probably damaging Het
Mib1 A G 18: 10,812,045 T981A probably damaging Het
N4bp2l1 C T 5: 150,572,781 E123K probably damaging Het
Npr2 C T 4: 43,650,432 R976W probably damaging Het
Rbpj T C 5: 53,642,195 probably benign Het
Ruvbl1 T C 6: 88,485,797 V301A possibly damaging Het
Sgip1 T C 4: 102,909,791 probably null Het
Skint1 T A 4: 112,019,151 Y90N probably damaging Het
Slc25a45 G A 19: 5,884,552 V183I probably benign Het
Slco4c1 T A 1: 96,821,200 H664L probably benign Het
Sult2a4 T A 7: 13,915,300 I194L probably benign Het
Tecta C A 9: 42,388,274 D173Y probably damaging Het
Tnrc18 T A 5: 142,759,704 probably benign Het
Trove2 C A 1: 143,770,882 E42* probably null Het
Use1 T C 8: 71,369,179 L169P possibly damaging Het
Zfp335 A G 2: 164,895,039 L918P probably damaging Het
Zfp451 A T 1: 33,780,052 probably null Het
Other mutations in Sh3bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Sh3bp2 APN 5 34556003 missense probably damaging 0.99
IGL02478:Sh3bp2 APN 5 34551662 missense probably damaging 1.00
IGL03196:Sh3bp2 APN 5 34557343 missense probably damaging 1.00
IGL03329:Sh3bp2 APN 5 34559202 missense probably benign 0.00
R0718:Sh3bp2 UTSW 5 34555495 missense probably damaging 0.99
R1322:Sh3bp2 UTSW 5 34555493 missense probably damaging 1.00
R1501:Sh3bp2 UTSW 5 34555576 critical splice donor site probably null
R1573:Sh3bp2 UTSW 5 34560690 missense probably benign 0.01
R1649:Sh3bp2 UTSW 5 34559004 missense possibly damaging 0.61
R1939:Sh3bp2 UTSW 5 34551619 missense probably damaging 1.00
R2021:Sh3bp2 UTSW 5 34544225 critical splice acceptor site probably benign
R2903:Sh3bp2 UTSW 5 34543556 nonsense probably null
R3709:Sh3bp2 UTSW 5 34551658 missense probably damaging 1.00
R4344:Sh3bp2 UTSW 5 34555542 missense possibly damaging 0.86
R4391:Sh3bp2 UTSW 5 34549718 missense probably benign
R5068:Sh3bp2 UTSW 5 34556967 missense probably benign 0.00
R5637:Sh3bp2 UTSW 5 34561048 missense possibly damaging 0.69
R5658:Sh3bp2 UTSW 5 34556947 missense probably damaging 1.00
R6005:Sh3bp2 UTSW 5 34562465 missense possibly damaging 0.65
R6014:Sh3bp2 UTSW 5 34559627 missense probably benign 0.00
R6391:Sh3bp2 UTSW 5 34561603 missense probably damaging 1.00
R6737:Sh3bp2 UTSW 5 34562474 missense probably damaging 1.00
R7144:Sh3bp2 UTSW 5 34561631 missense probably benign 0.00
R7536:Sh3bp2 UTSW 5 34543557 missense probably benign
R7871:Sh3bp2 UTSW 5 34559085 missense not run
Predicted Primers PCR Primer
(F):5'- TTCCGGGACAGTGTGAATCC -3'
(R):5'- TGAAGGAACCTATTGACTGGC -3'

Sequencing Primer
(F):5'- AGTGTGAATCCCGGCCTAGAAC -3'
(R):5'- ACCTATTGACTGGCAGGCAG -3'
Posted On2014-11-11